Description :
From Genome Similarity Track
Location :
Scaffold_146:5781- 8846
Sequence
3065 bases(100 bases per row)
CCAATCCCAGGGTAAGTTCTCACAGTGCAAACAGATACTGATACAGCTGTTACTCTCATGTACGTGCCTTTACAACACACTTGCGTGGTAGTCATTTGTC
AAAAGCGCCTCACACATCGAACCCCCCCCCTTCCGCATAACGCACTTACATCCTCCAAAGTCTGACTAATTCAGCATGCGCGCTATGATAATTGTCGCCT
TTGGTGTACTCGCTTTGTTTACGAACAGTGGTGTCGTAGCAAACAGGTCGCCTCGGAACTTCCGACGAGTGGCTGCTGCTGGGGAAGAGAACGACGTCCG
TATGAAAGCGCTCATACGAAATACATCGATCAGCACGACATTCGGACTAGAGGAGGAACGAGGGATCATGGGGGGACTCATCGAAAAGCTAAGCAGGTAT
TTTAAGGCCGTGTATCTGAAGCTGTTTGTTAAACTACAAGTGGCAAGAACAGACCAAGATAAAGCCATTAAGGGGCTACTGAAGAAGAAATTCAGTCCGA
AGAAACTGTACGAGTACCATCTAGACGTTTTCAAAAACCGGTATCTCAACGACGGCAGCGCAAGCCCGGAATACTCTCTGTATTTGTTTTTTTATGCTAA
AATGAAGCAGCCATGACAACACAATACTGGTTCAGCGGCACTGCACACTTAAATAGACTACAACTTATGCAGCAATAATGAAAAATATCGTTTTGATTTG
TACCATGCTGGTGTTATTGGTGCATTTCTTTGCCTCTTACGCGCGATCGTACACATTTTGCAAACTTAACCTTCTCGTGAGTGATCAAGATATCATGTTC
GAGGCAGTCGCAAATGCTTAAAAATTCTTTTGCTACTGCTTCCTCGACCTTTATGTCGTTCAGTAAACAATAATATATTAATGAACACCATGTGCGGCTC
CCGCTTGACTGTATCAATTCAGTACGTTAATGGCATTCACTTTCGCGTGCATTTGCCTAAAACGCAAATTATATTTGTAGTCCTCACAATTGACATTATA
TATCTCCATTTGGATTGCTTATGTCACTGTCGATCGTGTACGCCCCAGTACTAAAGGAAGCACCGAAATTTTGGCTCACCACTTGGAAACTTCCGTCGCT
CAAATCGATTTCATCAATCGTTGAAATAAAATACACTCCCTTCAGTTGTGCCTTACCGCTGGTATCCGTCCAAAGCAACTAACATTTAGTTTTCTGGGGC
TTGTAACGAAGTGATAAATCGGCTTAGTGTTTAGCGCTGCCCTTATCATGATTGACATTTGTTGCTTTAAAAACAAAAGATCTACGAGCCATATCTAAAA
AGTATCATGGTTATCGTGTGATCAATATGGTTGAAATATGCCAAGCCAAAGCTTATTTAAGCTGCGGGTAGGACGCATTCAAATCAAAGAGGATATGATT
GTCGTATCCAGAGCTATTACTCTTAACTCGTTCATTCATTAGCTTGCTGGACAAGCACCCATTCTGATGCTTACATCACTACAATATCAGAAAAAATAGA
ACCCTACATGTCTGCGATAAGCAGCGATCATCAAAGACTTTCCGTTTGTGCGATGGACACAAGCTATCCCTGAGTTTCGAATATATCTACAAAATTAGCT
GTTTATAGATGCTTTTCGCGTAGGTTGGGCAGGACAATTGTTTTTCTCTTAATATCATTGTCAGTGGGCACTTGTATGCTGTCTTTCGCCTCGATTTCGT
CAGAGATTGCATCGTTACAGTTTGCCTATTCACACATCCTAATATATCATCTACACTAACAATCTTATCGATAAATATTTAACACTTGGAGCTGTAGCTT
CACACAGAGACGACTAAAATTTAAACTGTTTCAGCCAATTTCATAACAGGGGAAAACTAAACACACCCTCGTACGCTTCGAATTTTTATTTCCCTTATTA
AATATTTACGCGCTCATCTCCAGCATCGCAATTTAGCATTTGACGACCAACCAGCACAGACGAGACCCATCCTTCAAAAATGCTTCAAGAGCGGCAGACG
ATAAGGTATAAATGTATATTCCATGACTATGAAATGCGTGAGCACAATTAGCTAAGCCAGGCTAGATAACCACCAAGTCGCGTGACAATATTCTTTTTAA
AATCCACAAAGACAATGAATCGTAGGCCAATCCAAAGCATCAAGAACTTACCAATAGACAAAGCGTATGGCTGTGAACCGTTACGCACCGCTTGCATCTC
GGCAAGTCAAATTTGCGAAGTTCGCGGTATTTCAAGATTCACCATGTGCGACTTTATCGTACTCTAATAAATAGTACTATCAAATTTCGTTGGTGCCAAT
CGTTAAGAGTGTTACTCAGGATATCGAAGCTTCTAGTTGAGATCGTTGAGCTGTATAACAGCAGTCACATGTGTACGAGCACTGCAAGAACGAAATCTAA
TTAGTGAGCATGTTACGCGATTAGTTTGAGTGTATTGGTCTTTTTATTGCGAGTGGTGTATGTTAAATTGAAAGCACAATCCCCTCCACGAACTTATCTA
TCTCCATTACTCGATACTTTATGGAACATTTGCATTACCCACTATTCTGTTCGTCAGCTGGTAGCGAGGTGCGTCTCATTTAATTAAACTCGGCTATAAT
GGTAACGAACCTTTATTTTGTTAAACAGATTAGTTTGTACTGCAGCAATCGAGGTCATCGAGTCTTGCATTCTATAAAATTTCTATATTGACCAGCGATC
TCGCACAGTACTTATACGTGACGCTCGTTTCGCTGCACATTCCATTCCTAAATGTACGTCGTGCAGTATACATCTTTTTATCTTAATTAAGAGAAATATA
TGGCGAGCAATCCAGCACAGAGTAAATTACTTCTACTCTTACATCCTAATTTTAAGGCAACAGATTATTCAGGTAGCTTCGGGAAATGACACCACATAAT
TTCCTGAAGATTAAGAAGGCCGTTATATGCCCGATGTCGTAAATTGACATATCCTTCCTCACGTGTCACTTTTCTCAATTGCATGGCACGATATCAACGC
TTTTCTACCGCAATTATGGTGCAGTTCTTAAATTTGTAGTCGTCTAAGTAGCTAACTACGCCAGG