Description :
From Genome Similarity Track
Location :
Scaffold_2:5781- 7594
Sequence
1813 bases(100 bases per row)
GCTTGAGGTCTATACGCGAGCGTAGATCGCTGACGCTGGCCCAGCAGCGCATTAAACGACCGAAAAAAGTCGGACATGAAGCTCGGTTCCTGGTCGTGCC
TGATTACTTCGCTGGCTCCGTACCGCCGAAACACGCATTCCTCGTATGCCTCAGCCACTGTTGGTGCGGTCCTGTCCGCGTTTGCCTTTGCCACAACGAA
GCCGGTGAAGAGATCCACGAAGACTAGGAGCTCTGTGTTGCCCTTGAACGACTTCGGGAGGGTGGGGATATGATCCATAGACACGACCTGGAAAGGGTAA
TTAGCGGCGATATTGCCCGGCGATCGCCCCCGCAAGGTGGGGTTTCCTTTTCCCGTCTCGCAGCCGACGCACTCCCCGACATACTTCTGCACACTTCGGA
ACATACCTCGCCAGTAGAAATGCCTCCAAAGCTTTTGGAATGTTCGGCTGACTCCCTGATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATC
TTCGTGGAGTGTACTCGGCATTACCAGTTTCACCATAGATCCACGGTCCTTGACATCACCACCGCGCCCCTCGACTGGACAGTACATCAAGAGACCATGC
TCGTCGACCTCGTAACTGTCAGCCAGGTTACTGCACGTCTTGGCTTGACGGCTCGAGATCTGAGAGAGATCACCGTGCAGGAAACACTTCAGTGACCAGA
TCCACACCTCCTCGTCTTGAGCACGGCAAATACGTTCCAAGCGCAGCTGCTTGACGACGTCTTCCTGCAACACGGCTGGTACGACAGTACGAGATCGGCT
TCGCGTGACAGCGCCTACCTTCGGATGGGCGTCACGATCTTCGCGCGTCTTGAGGAGCTCGTCCAGTCGATTCAAGGTCTCGAGGTCTGTGTAATCGGTG
TGACTCTCGACAACTACCCCGGCACCACGCTGCAGCGCCTGTCCCACCAGCATATCCGCGGGTTGGTTCCAATCGCGTTTTACGTGGATGAGTTCGCATT
GCGGCCAAGACTCTGGCCTTCTCACGCAAGAGCTGGAGTCCCGATGACTTGCACTCCACCTCTCCACGCAGTTGGCGGATGACTAAATTGGAGTCGCCAC
ACACAATGAGACGGTCGATCTGGAGATCGGCAATCAAACGAAGTCCGAGAAGGAGGCCATGGTACTCGGCCTCGTTCACAGTGAGGTCCGGTAAATAGCC
AGATTCAGCCTTGACAACCTTCCATCCAGGAGCATCCCATACCACAGCGCTGAAAGCTCCACCAACTCGTTTCGGCTTGGCCGATCCGTCAAAGCTGACG
ACGCAAACGTTTTCTCCGGGCGTAAAAGTCGGCATCGGGATAGCCAATGCTCTCGTCGACTTCTTCTGCGGAGAGATCTCCTCCAACGCTGCATCCATCT
CTGCGCGCGGAGTGATACTGGCGGCAACCAAACCTAGTAGCTCATCTTCGCCTTTCGCTAAACGTTCGATCTCTAGCGAATGGGGGGAGAGCAGCGCCAC
CCACTGAGCTAGCCGTCCCTTCAAGCCTTTCGCGCGGAAGAGCCATGCGAGAATCGTGTGTCTGGTGAGTACTCGGATGTGTCGACCACTCAGCATGGTG
AAGCAGCTATCGAGGATTCTTAGCAGAGCCAGTACTTCCTTCTCCATAATGTCGTACCCGATCTCGTGAGACCGCAGTGTCCTACTCGTAAATTTGACGG
GTACGTACACTCCATCACGACACTGAACGAGAGAGGCAGAGATCGCCCACTTGCTTGCGTACACAATCACAACAGGATCCAACTCTGGGGCAAAATGGTA
GAGCATGGGTGCG