Description :
From Genome Similarity Track
Location :
Scaffold_104:57808- 60182
Transcript NameFunction/comments
Albla_Nc14069710hypothetical protein SORBIDRAFT_01g039390

Sequence
2374 bases(100 bases per row)
CGTTCCAACGTTCGTTTCTTATCTTCTAACTCACGCAATGTCGCTTCCTCATGATCATCCAACCATTCCCTTGCGTCTCGTAACGCATTCTCCGCACCAG
CTTCACACTTTTCATTACCGTTATTCAGTGCGCGATAAATAAATTGTTCCAAACTGTTACGTGCTTCAATTCGCGCGAGCATTTCCGCGTCATCTTTCTT
GAATTTTTCAGCATCCGATACCATTCGATCAATATCCTCCTGACTCAATCGCCCGCGATTGTTGGAAATCGTAGTCTCCGCTTTCGCGCCCGTCTTCTTA
TCGGTAGCAGAGACATTCAGAATCCCATTGGCATCGATCTCAAAAGTCACTTTGACCTGAGGCTCTCCGCGACGCGCTCTCTCAATCCCGGAAATCGTAA
ACTCTCCCAATTTGTTGTTGGAATCCACACACGCTCGCTCACCTTCATAAATGCATACATCCACCGCCGTTTGATAATCTTCTTCAGTCGTGTACACTCG
GGTCTTACGGACGGGAATTGCTGTGTTTCGCTTGATTAACACAGACATCACTTTCCCAACGGTCTCAATACCCAATGATAACGGTGTCACATCGACCAGC
AAGAGGGAATTGGTGGCATCGTTACGGATCCCATCGAGAATAGCTCCTTGGACTGCTGCTCCGTACGCGACGGCTTCGTCGGGATTGATCGATTTCGATA
GCTCCTTGCCATTGAAAACGCCCGATAACAGGTTCTGAACCTTGGGGATACGAGTGGACCCACCCACAAGCACAATTTCAGAGATATCACCGGGTTTCAT
GGCGGCATCCGCAAGGACTTTGAGCACAGTTTCTTCACATCGTTTAAATAGTTCTTCATTCAATGACTCAAATTTCGCTCGGGTGACAGTGAGACTAAAG
TCAATTCCTTCAAACAATGAGTCCACTTCGATAGAAGCGGTCGTTGAGGTCGAAAGCATTCGTTTGGCCGATTCACAAGCAGTTCGAAGTCGACGCATCG
AACGGGGATTACTGGAAGGATCCGATCCACGATTCTTACGCTTAAATTCTTGGATCATATAATCGACCATATTGTTATCAAAGTCTTCACCACCCAAATG
TGTGTCTCCACCAGTGGCTTTGACTTCAAAAATACCATTTTCAATGCGTAGAATGGACACATCGAATGTACCACCCCCAAGGTCGAAAATGAGAACATTA
CAGGCTTTACCATCCGATCCAGCGTTCGTGTCGAGACCATACGCTAGAGCAGCGGCCGTTGGCTCATTGATGATTCGCTTGACATCTAATCCAGCAATGG
ATCCAGCGTCTTTGGTGGATTGACGCTGGTGATCGTTAAAGTACGCAGGGACAGTAACGACAGCTTGCTTGATGGGCTGGCCCAAATAGGCTTCCGCAGT
CTCCTTCATTCGTGTGAGCACCATGGCAGAGATCTCTTCAGGTGTGAACTGCTTGGTCTCTTTCTTATATTCGACCTGAATAAGCGGTTTGTCACCATCA
CCCGAGACGATCTTGAACGGGAAATGTTGGGCATCGCGTTGGACAGCTTCATCGGCAAAACTTCGACCGATAATACGTTTCGCATCGAAAACGGTGTTTG
TTGGGTTGGAAGCTGCTTGAATTTTAGCAGCCTCACCGATCAATCGCTCCGTGTCAGTGAAAGCGACCCACGAAGGAGTCGTGCGATTTCCTTCCGTGTT
GGCAATGATTTCTACCTGACCGTCTTTCCATACACCCACACAGGAGTAAGTGGTTCCAAGATCGATACCAATGACTTCACTGAATCCTCGTTCAGCACGT
TCTGCGCGTAATTCCCGTTCTTTACGTGCTTTATTGATGGTTTCCTCGATTTCCATACGCTTCATTTTACGTGTGGCTTCATCCATTTCCACTCCATTTA
TCTCCTCCTCTTGCACTTGTAGTGCTGCTTGAGCTTGTGTAAGACCAGCTTGAAGCTGTTTGTTACCTTTATCAATGGTCAATCCTTCCGTATACGCAGC
CACAGCCTTTCCATAGTTTTTAATGTAAAACTGAGTCGCACCGAGACGAGCGTATCCTTTAGGGAACTTCGGGTCCAAATCAATGCATTTCTTGGCGTCC
TGAAGCGCTTGTGTCGCTTGTCCGGAGCTCAGGTACGCAGCGGATCGGTTGGAGTAGTAGATAACGTTTTCCGGCTCATAGGCGATCGCAGAGGTGAACT
CTTTAATCGCGGCAGCATGGTCTCCAGCAGCGAATGCTGTGTTTCCTCGTTCCTTCGCTTCTGCGCCAAGTTTTACACGTTCAGCTTGGTCTACACCAGA
GTGAGGATCTTTTGTGGTTTTACGATTGCGGCGCTTTGTAGGAGCCATTCTTTTTCGTTTATAAGAGTGAAAAT