Description :
From Genome Similarity Track
Location :
Scaffold_238:57804- 64925
Sequence
7121 bases(100 bases per row)
CTCCGCTGACGCTGATCTACGAAACTTCATAGCCATCAAATGCCTCCTGCATNNNNNNNNNNTCTAATATTGTTAAAATGATACCACATCTGTACCGATA
ATCGTCATATACATGTTGTGGTACTTTGTACCGGATTAATGGAAACAAAAACAATAAATTTATTTTAACCTACGCGTAAGCTCTTTATACGCTCTTCCAA
CAGACTGTCGACACCGTAGTAGACACCTAACGCTATTTTCTTTTATAGTTTGGTGCTTACAATGTATCTCACGGTTGCGTTCGATCCAAGACACAATGAG
GCCACCACATAATGAGTCAGAAACTTCGTCGACATCCTCAGCGGAGGTATACGGTAGATTGAAAGAGTGATACAATCCTTCAGGTTGAGGAGAAAATCGA
ACATAGCACAGCTGTGCATCAAGATCTAGTGCATATTTCAGTCAAACCTTTCCGTAAATATGTTGTTGCAAATTTATTGACATTATATGGTATCCTCGCC
ACTTTATCAGATAGTGGTACTGTCCCTGACTCAAACAGTTAAATGTTCTAAACATAATACGATTGATTCTTTTGCTCATTTGCGCATCGTGGGGACGAAG
AGGGGGGGGGGTAGCATAGACAATGGGTCATGACGTGCTAGCATCTGGTGCAACGTCTTCAGTGGTTTCTTGTTTAGGTAAAAGTAATTTAAAATATCAC
AGATCGTAGTAGGTTTACTATGTGAATATGTTAATTAACCGGGTCCACCCGAAGTATTCTAGACTCAATTTCGCACCCTGAAACAGCTTCGACCCTGCTT
GGAGGGCCAGATAGACTAGTTGATGAAGATATAAATGTCGGTGCAGGGCGTGGCTCTCTTAAAACGATGCAACCTCCACATTCGTGTGGGTCGGATCGTG
AAACGACTTGTGGCAAGCCAACGTTCGTTTAGAAATTCACTTGATTCTAAAGATTCGAATGCAATAATTTAGAATTCCCCATTTTAAGGAATCAGGGTGG
AATCTAAGGTCATATAAGATGGAAACTTAGGCAGTTACTATGAAACTAGAATGACATCAGGTGCACTAACGCAACGAGTACTGAAAATTCTTATCCTCTT
TTGCTAAAAACGTAAGCTAAACTTTATTTATGATTTATGTACGCTTGTAAACCATTTCTAAGTAGAGCTCCGTCCCGCAGCGTCCCATCCTGTAAATTTG
TTTGATCGAACGTGAAAACGTTTCTCTTTCCTCGGTCTATGCAATTTTGAGAACAGAACTATCGGGACCCCTCTCAGAGGGTGAACAGATGCACATCATG
CTATATTTCAAATCGAAGTAAGTTTTAATCTTAGTGGTGATCTGTGACGACGAACAAATTCCTCGGGTAGCTCCCCTAGCTTCAATGGCGTAGTTGCTTC
GGATTCGATGAGTCTTCCAGCTCATTGTCGGCCCACTAATTGACGAAGACGCTCATGAAAGCTTGACGGCTCAGAATACCTTGCGTTTTGGCAAAGACCT
CAAAACGTCGAAGAGATTTCTATGAAACTGCTATATTTTGCTTTTGTTTCTCATTCATCTTGTTGGTCACGCTATTGGCTACACATAAAGAGTCCGATGC
ACTACCATTTTAACATTCGCAACAACATATTTACGGAAAGGTTTGACTGAAATATGCACTAGATCTTGATGCACAGCTGTGCTATGTTCGATTTTCTCCT
CAACCTGAAGGATTGTATCACTCTTTCAATCTACCGTATACCTCCGCTGAGGATGTCGACGAAGTTTCTGACTCATTATGTGGTGGCCTCATTGTGTCTT
GGATCGAACGCAACCGTGAGATACATTGTAAGCACCAAACTATAAAAGAAAATAGCGTTAGGTGTCTACTACGGTGTCGACAGTCTGTTGGAAGAGCGTA
TAAAGAGCTTACGCGTAGGTTAAGATAATATTTATGTTTTTGTTTCCATTAATCCGGTACAAAGTACCACAACATGTATATGACGATTATCGGTACCAAG
ATGTGGTATCAATTTTAACAATATTAGAAGCAGCCATCATATGGAAACCAAAAAATGTTTTCCAATACTGAGTTCTATATTAATTATTATGTCGCTGAGA
GAGAGTGATCAGGCACTATGTGTAAAATTGTCGTTAAATCATAATTGAGTCCAGTTCGCCTTTTAAAACAGAGAGAATACAAGCCTCAAGAGGTTGTTGG
TTCGAGCCTTGTGCTGTTCGAACTTTAATCGTTTGCTGATTTGTAAGCTGGTCGACTACGTGAAATTACAACAACATTTTAACTCTTTGCACTAGTGGCC
CTTCAGACTTAGATTTTATTCATACAAACTAAATGACTTCAGAGCCGAAGTTATTCCTCTGACTAAAGAGCTATTGTAGCTTCGCTACATTAAATTCAAC
CTGAACTTGGAAAAACGCCACGAAAGTGGATATGTGAAAATGAGTCGGTGCGTCTCGTACTCGAGGACCTTTTGCCATGACCCGACTCAATATTCCGATG
TATACGTCCCGGATGACGCTGAATTCGAGCGTTCATTATGGATTGAAGGAGGGTTACAAATCTTGCACCTAAGATAATAGAAGGCAGTTCCTGCGTAATT
AGCATCTACACCAGGTGCTCAAAAGTAACAAGTACTGCAAGGCTTAAGCCTTTTTACTCAAAACGTGAATTGAACTTTATTTATGATTTGTACGGTTATA
ATCCTTGTCATAAGAACCCCAAACTTAGAAGGCAGAACTAGTTAGTGGGTAATACATTAGTCAGTCGTCAACGTACGATGAATTTATTGCTGCTGTATCG
ACTATAACACCATACCTGATAAGGTACGGTTTTGCCGAATGCATATTTTACTTTCCACACTTAATACATCCCTAAGGAGATTCTATCAAGGTTACCATCA
ATGCAATAACCATCGTGTGACCCCATTATATCATCCCCACCAGAATGAAGTTAGCGCAGAATGTTACTCGATTGATGTTCTCATTGAGGAAGTTGTACGA
GAAAAAAAGAACGGTTGTTCAAGTGTACACCAGCATAACTCACAATCAAGGACGTATAAGGCTCTTCGTGAATTTTTGAAGAAGGCCTACAGAAGGTAGT
GGACATTTATAGGTAGCACAGACCTTAGAGGAAGGATGAGTCAATAACCAGAACACCAACTAGTGAAAAAGAACCTCTCCATGCACCAAATCTGTTCCCT
GAACGTGTTTCGCGAATGAGCTAATCGCGTTACGATTGATGCCAGTCTCAGCGTCACCAGCGATCACCACGAACCCGCTCTATAAGCAACCACAGCTAAA
TGCGAATCAGATGCAAAAATGATATGTCTTTACGCGACATGATGTGGAGGAACCACCAGACAATCGGCCAAACATTGGCGGGGTGTTCAATAGACCCTCC
AGCTACTCCTTCCGGATAAATGAAACGCGAACGGATCTTTGTGAAAGGTATCTTAAGCCAAACGCTACTACGCAGAGCCGATAAAAGTCACAGGTGATGA
AGCAAGCACGTAGTCCATCGTTACCTGCCATAAATTCATGTTTTTACTATTATCCGCGGGTGAGACTGAAGAAGAGGAAGACAAAGCGTTCATACTTTTG
GTGCATCATCACCGTCGCTTAAATAGCATGACTGACCTTAAAAGCATGTCAGTGTGAAGGATGTTCGTCATGAATGGAAGCTTCACTATCAATTTGCGCT
TGCTTGCTAAAAGGCCAGTTGCTGTTGGCATACCGATCTCGCTATGCATATCCTGCTTTCCAACACCGAAGTGCTATGGCTATTCATGTAGCCGCTTTCC
ACTTCAGATGTTGTCCATGGACCCGTTTGCTCCCACCATTACTAATGACAACGTCCTGTGTCGCAAGTTCATCCTAACCGCGGCGTTAGAAACATATACG
GCGTTTGGGAAGCACATATTGCCTATATTAAAAAAAATTCAATCTTCTTTAAATTTTCTCGTACTTCCATACGCTCTCTTATTTCCACACCATTTTAACA
GATACTGGTATTATCCACGACGAAGACATCAATAAAAAAAGCTTTGCCCCATAAAACTAGAGGTTTCCTCGCTCATCGAGCTACGCCGGCGGAGGCTGGA
GTTTTGGATAAATCTCACGCGGAGTTATTTCACGAAGTAAAATGGATCCGTGGGACTTTGGATCAGTCTCATAGCACACCAGACGCGGTGCAGACTCGCC
TTTAGGCGCTCAATCACAAGCAAGCTCGTAACACGGAAATACTTGCCTTTCTGATACGAATGCAACAGCTCGCGCTAAGCCGGCTACGTTGCGGAATCGC
CTCCATATTCATTTGAGTCGGATCGCGATGCGACTTGTGGCAAGCCAACGTAAAACAAGGGGGTTGTACAAAATTTGCGTGGAAGGATCAGCTTATAGTC
TGTGGACTCCTTGGTGATGACCTTAAATGTTCCAAAAAGCGCGGACGCAATTTAGAATCAAAGGTCGATGAAACTACTTTGGTAGTTAGCTTCTTAGCGT
TTAGTAAGAATTGGTCACCGACCTCATAACTCTCCATACATCTTCAGCCCTTATTGTCAGACTGTTCTTTCCGTTTATCTTGACTTTCAGTCATCGCGTC
ACGGACAAGCCGTAAGATATCACCGTGCGTTGCTGAGAACGCATTATCCTTTTTGTGTACAGTAGAAGAGCTGGTATAGCGAGATAATCGGCGACCTCCC
CACCAAGACCTGAATAGCTTTAGGGAAACTCGCGGGTACGTGAGGCCCTTCAGACAGAACGGAGTATATCCGGTAGAGGCACGCACACTTTTTTAATTTA
AGTTCAGCAACACGGAGTATAGAAATCTAACGCGAGGCGTATCAGCCCAAACGATGAGTATGGTATCTTCAACTGCGCTATTAACGTGCTCAGTTTGAAT
ACCGGTCTGTGGATGATCGGCTGTGGATATGTATAATCGTGCTCTGAGCACCAGGAAGATGCACTACCATAAAGGTCCCAGTGAAGCGAGGTTCACGATC
TGAGAAAATTGACACGGGCAATCCGCGATGATAAAACACGCGATCGATAAACATCCAAGATATACCTTTTCCATCTATAGAGTCCGGCACAGCTGCTAAG
TGTGTAACTTTACTCAACTATTCAGCACATACCACAATGCCCTCAGGTAAGAGAACCACATAGTCCATACTGATAGAATTCAACACCCAGAGAGAACAAG
TAAACGAGTCGGAGGCACTTTCGCGTGCGTTGGCACCTTTTTTCGTACTCACATATGTGCTAATCCACTTGCCTTTTTTCGGGTCTCCAGTAGAAGTGGA
TGACCGATCCGTAGGTCTTCACTCAACCTAAAGGACCACTCAGAGCAGTACCATGGGAGTCACATCAGATTCTATATTTCAGTTCGTCATCATAGGGAAA
AACGATGTGCAGATAATCCGCCATATCCGTTCTATAGTACTACACACCGTGATCGTCGTAGTATCGATGCAACCTCTCACACTAGTGTCCCTACAGCTCA
ATGTCCGAGTCTTCACACTACTCGCTCCCGAGAGCCAATAGCAAAGCTACACATTGTTTATCATGTGCGAAAGGCAGCACGTATTAGATTAATAAGTGAT
GACGACAGCGTCGTGAAATGAGCAAGACTATAGTCCAGTACTCGGGAGAATGTATAAACTAACGCATTTTTTTTACCCGGCTTACAATTCAACTCGAGTT
ATATTCAGGAAATATTAAACGCCAGAGGTCCGTTATCTGCGAGAGATGAGGCGATTGAGTCGCAGTGCACAAGACGCATGATTGGTATATATCAACAATG
GCTTGGAGCCAAGCATATGAAATCTGAATGTGATAAAGCATACTTCATCTCAAGTAGCTCTTTGTGATGAACTGATTAGTTATTTGCTGCAGTCTTAAAC
TGGAGCGATTTGAAGGTGATCATACGCTTAATTCCATCAAGATCTTTTGTAACAGAGCAGTGCCAATGGCAAATCAGATGCTTCAGCAAAGACATTGAAA
GACCGATCAGTGTCACTCAAAGACAGAATTGGGTTATGAGTAATGACCCTTTTTATAGATTTGAAAAACATCCTCGTGTTTGGCATGCCAACAATACTCC
ACATCCTTTTTAAGAAAATTGGATAATTGCCGAGCCATATCAGTGTATTTGTCTCTGCACTTGTGCAAGCAATCGGCAATGCCAAGCCACTTGCGCAAGT
CCTTCTAGGCCTGTAGAACCGGCTAATCGACAATGGATTTGACCTTATCAAAATCTGCTCTTAGGCCTCGCTTCCTAATGAGACATGTTAAAAGAAAATC
TCTCCAGCACAAAAGATGCAATTGGATGCGACAGCGTCATGCACTCGAGTATTGCCTGTAAATGACCAATTTGAACTTACGTCTTCGATCTTCCGTTTGT
GGCGCAACTATGGACAGCATATCATCGCAATAAGTCGATGCATAACTTCTGTGAGGACGGAACAATAGCTTCACCAACCAGTTACACGTATTCGGATCAT
TGGATAGACCGTAGAGAGTAACCAGCCGCTCCCAGATCATGCCGATCGGAGTGCTTGCTACTGCGAGCGGAATACCGCTAGATCACATGTGCAGATGGCA
ATACCCATCGAATAGGTCGAGTGCGCTGTACATGGTGCAGCCAACCATATAGTTATAAGAATGTATTTCCTATGATTCGGTGTTTGTTCTGGAATTGCGG
CCGTATTAATATGATTGTATGTGTAAGAAATACGACACACCCCATTCGTTTTCCGAACACAAAAGATTTTGGGGAACGCGGAGATTTACTATCACGCACC
ATAACTGCCGCGTGTTTTTCACGATAGAACTTGTCAGTGACGCCACACTGTTTACTTGGGAAGACCCCCTGCCGTAAAAAAGAAGTATTTGGTCCCAGGA
ACAAAGTCAATTTCATGACGTACACCTCGATCAGGAGGTAACACCGACAGTAGATTATGGTACACCACATCTTAAGACTCCTCTACTAATAAAACAGTAT
ATATCGGAATTACTCTTTAAGATCAACGATCCACTGCGTGCAATAAGTGTCGCATTGGTTCTCTTGAAGACAGCTTTATCCAAAAGAGAGAACGATATTA
ACTAAGCAACAGGTCTAAAGA