Description :
From Genome Similarity Track
Location :
contig_124:57804- 61462
Transcript NameFunction/comments
g13514.t1hypothetical protein

Sequence
3658 bases(100 bases per row)
GCCAGACGACGCGTTCGCGCGCGAGCCCGATTGCGGCGTGTGCTCCAAGTCCTTCAACATCCTGCGACGCCGCCACCACTGCCGAAGCTGCCACATCGCC
GTGTGCAAGGAGTGCGGGCGCAAGGCCGTCGACCGCAAGAAGCCCGTGCGCTCGCGGCCGCAGTGGTATTGCCTGGGATGCCTGGACGACGACGCCACGC
TCGAGATCACCGGCTCGCGGCCCACGGCGAGCAAGCGCCGGAGCTTCTCAACGTCTTCGTCGTCGTTCGCGCCCACGAACGCGCCGCAGGTCACTAATGT
GAGTGTGGATTTGTGCAAGTTGAAGTGCCTGTTTTTGACGGATTCTAACGGTTTTGTGCCCTCTGACAAATTGGTGCGGACTAGTTGACCAGCACGGCCA
AGTTCTGCATCGAGTGCGGCTATGAACTGCCGCTACGCGTCAAGTTCTGCATTGAGTGCGGCACGTCTGTGCGGCAGCAGGTGATGTCACCGGTGAGTGT
GGACGGCGTTGGCGCTGCAGAAATAGACAGAGGCAATCGCGGCTTCCGCGACTCACTGGGGACGAACCTCCTGGTCATTGACGAGCACAGTGGGTCGCCG
ACGGAGCCGACGGACGGATCAGAAGACGATGCGCCGGTTGAACAGGAGCCCGAGGATCACGATCCGGTGGAGAAAAAAGTGGAAGTGGCGGCACCTGAAG
GGGACGAATATACAGCTGCAAAGACCAAGGAGTATGAGGAGCTTGTGGCGCAATTGCAGGCGGAGAACGAGAAGCTGCGAACTCGTGTGGAGAAATTTAA
GCATAAGATCTCCGAAGCAGAGCGTCGTCGGCAAGAAAGAGAGGAGGAGCACGCTCGCGCAGTGTCAGAGGCAACTGCAGCTGCAACGGCTGCTGCGGAA
GCCCAGGCTAACAATCGCAGTGCATTGGGCCCGGCAACTCAGGCGGCATCAGTACCCGAAGCGGTAGGACCTACTAGCAATGGAACGGGTGTTGCTGCGA
AAGACCACCCGGACTACTTGAAGTTTTTCAAACTTCTGAAGATGGGTCTACCTGATGAACAGGTAAAACTGAAGATGGAGGCGTCGGGCGTTGATCCTTC
GGTCCTCGATGACCCAGATGCGATTATTGGAGGTGCCGCACCAAGTGTTGATAGTGCACCAGCTGCTCCTGTATCGAGTGGTGGTGCCCTGGTGAAAGAT
GACGAGCAGTATGCTAAGTTTTTCAAGCTTCTGAAGATGGGGATGCCTGCTGAACAGATCAAGCTGAAAATGACCGCTGGTGGTTTGAATCCGGACTTGC
TTGATACGCCGGATGCACCAATGCCCGGTTCCGCGGGCGCTATCGCACCAGCGGCAGCATCTAACCAGGTGATGAGCGTGAAAGAAGATCCAGCTTACGA
GAAATTCTTTAAACTGGTGAAGATGGGTATGCCTGCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACACGCCAGAT
GCGCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACAGAAGCGGTGAAGGTGGACCCATCGG
CTTTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAGCCGAATGT
TGAATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGGACGTGGAC
GAGATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCCCAAGGAAG
TACTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTATGCTTTGGA
CGGGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGATGTAAAG
CTGCTAGGAAATGTTGAGAAGTTCTTCCTTGATTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTCGAGAATCG
CATCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACATTTTGGCG
ATCGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGTTGATCCTC
GTGTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAGCGAAGAGA
CTGTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACATTGAGGGT
GACAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTGCTATCAAG
AGCTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGTTGGGCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAGGCTTACCG
TCAAAATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGCACGAGGCC
GAAGAACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTGGGCTGGGA
AGCATTCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTTTGTGACCA
AGTGCGCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAATAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGCTAGAGGCG
TTTGCTCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGAGAGGGCGG
GGTCCTCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTGCTTCACAA
GTCCATCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGCAGATCACG
GCGCACGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTCGGAGAAAC
GCCACGCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGG