Description :
From Genome Similarity Track
Location :
Scaffold_1456:5780- 9689
Transcript NameFunction/comments
Phyta_totarag13026hypothetical protein

Sequence
3909 bases(100 bases per row)
GGCACCTTGATTAAACTCATACAAGAGTGCCCCGCAGTTGAGTTGTGACATCGGCAACCACTCGGAGTCCGGATATCCTTTCCACTTGACAAGATACTCC
CGAACGCGTCGTGAGGTACGTGTGCGCTTGGTCCACCGGAGGTCTAAGATTTTTTCCACTTCGTATTCACCGGCCTGGTTGTCAGGTCCCCAGCGGTCTT
CTGGAAGTAGCGccgcgtcatcgtcgtctacATCGATCTGGACTGTCGGGCGTTCTGGGAATAACGCACGCGGCTTTAATCGACTGACGTGAACCCAAGG
ATTAACCCAATAACCGGTATCCTCAATCTTGAACCTCACTCGGAAGTCGTCGTGCATTTCCGCGATCCTGAATGGACCATGCCACTGATGGGATAATTAT
CGACTCAATCCTGGTTGGACGCGAGGAATGTATAACCATACTGCGTCTGCGACTTCGTATCCGGCCTTCATGCGTTCTGCCAATTCACGCCATTTCTTGG
TCTGTTCCTCCGAAcgcatcttcttggctttcttctGCAAGTCCTTGGCACACGCAAGTGCGTAGCTGTAATCTCTTTGAAGCTTCCGCCGTCACTCATA
CGCAGTGCGTTCTGGAGCGCTCGACGGTTTCGGTCCTAACATAGCGGATGCCGTTCCTCGGGCGTCCTAACCGTGCACCAAGTAGAACGGGGTGTCGAGA
CGAGTAGCGCAAACGACGTATTCAATGCAAACATCAGTCGTTCTGCATGATTGTCCCAATCACTCTGATCAGCCTCGGTGATGTAGGCTTTTACGCTCCG
CATGATAGTCTGCACAGAGTGTTCTTGCTGTACGTTCGCCTGTGGATGATAGGGTAGCGTGGCCCGCTGCTTGCTGCCCAGGAGGTATCTAAAACGCGTG
AACacctcgctcatgaagcGCGGGTCCTGGTCGTGACGCAACAGAGAACTTGCCCCAAAATGCCGGAACACACGCTCCTCATAGGCCACTTCCTGGGCGG
TCGTTGAGCTCATGGGTTTACACATCACATATCCAGAAAATGCGTTCTGGAGAAGCAATAGGAACGTGTTGCCGCGTTCTGACTTGGGCATGTGGGTGAC
AAAATCCATTGACACTACCTCAAAAGGACGCCTCGGCTCGATATTCCCGGGCGAGGGCTCAGGATTCGGCGGTCGCCCCTTGGCGGCCGTGCAGTCCACA
CATTCCTTGACAAATCTTTCCACGTCAGCGTACATCCTTGGTCAGTAGAACCCACGACGCAAGTGTTCATATGTCCTCGTGATACCTTGGTATCCGCCCT
GATAGTCCTCGTGTGCATAATGTAACATGTCAGGACGCAGAGTTTCTGGGACAACTAGCCGAGGTTCGGAGACCATATCACGGGGACGTTCCTTGGTCGC
CCTGCTCAGGCGATGCAGGCTATCACGAGAGTCAAGGACGAACAGATCAGCAATCTTGGcaatcttcttgagctgagGCCGCGAGAATGCATCGAAATTT
CCCCTCAGGCACCGCTTCATTTGTACCAGGAGTGCATCACTATCCTGGTGCACTTCgcttcgacgccatctcTCCGCTTGATGATCTAGTGGGCCTCTAG
GCAACCCTGGTCAGACCTGTCTGTGCTTCGGGTCACTGCAAGCAGTACCTTAGCGGCATGAGTCAACGGTGCGGATTTTGGTCCTGGAACGGCGGCATCT
TGGACTGCTGTATCCTGGCCATCGGCGTTCTGGGCATTCTCACCCTGAGACGGTGTATCCTTCATCAGCTTTTCCTGAATTGTAGACACCACACGCAAGT
GTTCCTtctcatcctcgtcttcgatCCTCCACGACGTGCCAAGGACGAGTGTCTTGGAGATTATATAATCCGCGGCCGGGTTATACGCACGCTTTACGTG
TACCAACCTGACCGATTTGAACTTGGCCTTCAATACCTCAAACTCTGCTAGTCGTCGTTGCAAGTTGGGCTGGTGACAACCGATGAGTCCCTGCGCTTGT
TGGATGTCAATCCTGGAGTCACCTACTATCACCAACTCCTGGATGTCATGTTTCAGAGCCAGCTTCATTCCATCCACCAGACCGCAGTACTCAGCGTCGT
TAGCTGTCACACCTTCCAGAGAATATCCTCGAGCGTCAACAACGCGCCATCCTGGGAGTTGCCTCAAGATGCATCCACAGCTACCCTTGCGGGTGGACGT
CTTGGCGGCACCATCGAAGCTCAGGACGCATCCCTCGTGGTCGGCTTCCAACATCTCCATACTAACTGGAGGTGGAGCCTTGATGCGCCCTTTAGCCGGG
ATGAGTGTCTCCACCACTGCGTCCAAGTGCTCTCGTAGAGTAATTCCTGCGCCCATTATAGCCGCAAGTCCATCCTCATCGCGATTCATCTTGTGGATCT
CTAAAGGCCACGACATTAGTGCCAACAACCACTTGAGACACTGACCGACCATGGAGTTGGACTTCAACAGCCAACTCAACACGGAGTATCTTGTGTATAC
CTTGGTCGGAAGTGACGATGTCGAGAGTATCGGTCGGAAATTTTCCAAGACGAGAAATACTGCAATGACTTCTTTCTTCACGATGTGGTAGCGTATTTCG
GATTCGTTCAGGACGCGGCCTGTAAACCGCACCGGTTGAACAACACCATCATACTCCTGTCCTAACACAGCGGCTGCTGTCCATGGCTTCGCATGAGGGA
TGATGACGAATGACTTCGTGCGGTCTGGGTGACGTAATAGAGGAGTGGACACGATCTTGCGTCTTAGTAGCTCGAACGCTTCCTTCGCTCTCGTTAAGTC
TCGACCAGAACGCACTTGTTCATCTGTCAACTCATACAAGACGGCAGCGATTACTGGCAGATCTTCAATGAACTTGTTGTAGTAGTTCAAGCTGCCCAGG
GACGACTGCACTCCTTTCAGCGTGGGCGGGAATGGCAAATCCTGGACACTTTTGGCGATCTTTGGCATTGCTCGGATCCCTTCACCGTTGATCTCATGCG
ACAGGTACGGAATCGTCAGCTTGCCGAATTCACTCTTAGGCAGGCTGACCGAGATGTCCCAATACCGCAGACGATATAACAACGCATTCAGATCCTCGCA
CAGCTGTCCCCAAGTCTTTGCCCCGTGAGCGATATCGTCGATGTACGAGCTTCGCCCCAACATTGGACCTAGTTCATGCGGCATCGGGATGATACGCTGA
AAAACCGTCATGCTGTCTGTCAGAGTAAGTACTTCTGACACTTCGCGTTCTAGCGCTTCCAGTCCTAGGTATCCCAACACATCCTGGTCCACTTGAGATT
CTTCGTCTGGTGGAAGTTTCATGAATCCCCACAGACAGTTGTTGATGACACACTGATAAATCAGCGGTGCATTCTTTAATTCAAACGGCATCCTGACCCA
CTGAAAATATCCGAAAGGACAGATAAACGCTGAAATTAACTTGGATCTCTCCGTCATACGAATCGCCCAGAAACCGCTTGCCATATCCAAACTCATGAAC
CACATCATGTCATCGAATCCGATgagcaagtcgtcgatcagCGGTAGTTGAAAATGCGACAATCTGATGAACTCGTTCACCACTCGGCAATTGATGCACA
TGCTGATGTCTACTCCATTCTTCTTCAGGACGATTACAATCGGAGAAGCCCATGGAGACGTGGAGTACTCAATGAGGCCAGTTTCCAGCAGTTTCTTTAG
CAAGTCATAGACTTTCCGCAATAAATGAGGAGCGACTTGCCTAGAACGCTGTGCTACCGGCTGCGCATCTACTACGTCCAGGTCGCACACGTCTCCACGA
GCGGGTGCAGGAACAGTATTGTCATCCCCTAGAAAAATGCAGTAGTGTTTCTCCAGAACGTGTCACATCTGTTCATCCATTTCTGGTGTCGTCTTTCCTG
GGACACCTa