Description :
From Genome Similarity Track
Location :
Scaffold_405:5780- 7001
Transcript NameFunction/comments
Phyra_85985related to transposases

Sequence
1221 bases(100 bases per row)
TAGATATACACCGCAGAAGAACTCAGCCGTGGAGCTAGCAAACGGTCTAGTCATTGCGTATGTACGCTCTGCCGGAAGTGAAGCTGGGACGCTGCACTGT
CCGTTGACTTGCGCGCGCCAGAGGTCTCGGCTGACGGCAACAAATAGGACCTAGCGTACGAGGACGAGCTGAACGAGCTCATGCAGCCGTAGGTGGCCGG
CCGGCCTAAAGGCAATGACCACTTCACATTTTCCTTCTCCCTACCAAGTCCAAGTTTCCTACAACCATCCGCTTGACACGCTCGCTCTTGAGAATGACGT
TGCTGTCAAATATGTTGTGTAGGGAAGCCATGCATCACTCTATTTACCCACTGAACAGGACTCCAGCTCACATTCTAGACTTTAAGTCACCACATGAATT
GTTCAAAGGTGCACCTCCTGATCTCTCACTTGTGCAAACTTGGGATTGTATATCGCAGATACGGGTCCTAGGAAAAACTCGAATCACGGACGGAAATATG
TCTTCTTCTTGGTTACAACACTGACATGAAGGGGTTCAAGATGAGGAGCCTTTGATCAAGTGCAATTCGTACTTCCCGATTGGAGAATGCCCTTTATCAC
GAGGGGTTCATCTACCAGGCCGAATATGTAATGCAACTCGTGATGAACACTTTTCTTGATGGAGATTACAGACTGTCTCAAGACCTGCCAAACGTTCACA
TGAAGACTGACATGGAATCGTACGCGGTGGATGCTGACAAGGAACAGCCTCCCTTTGGCGTGTCGGTGGAACCTGATAAGGCGGTGCCGAAGCGCATTGA
TGATCGTGCGCCTTTGGCGAGTGGGAGAGTTGTAATGGGCCACGCTGACCAACATCGTTGCCTGGCAAAAGAACTTGTGAAAGGGGGAGATCCGTTGTTC
TTCAGTGTGGGTCACACACGTCGCACTAAGTATAATTTCGTATTCAACACGAGTTGGTGTGCGGCACCCTGCAGTACGCTTAGAAGGATTGTGTACAGCA
TATGCTCCCACCTCCGGTATCGTGGTCCGACCATATTCTAAGATTTGCTATGCATTATCGTCGGCTACTTAAATACTCAACTGTGAAGCTCAAATGATGA
TATCCTCCAGATCAACGTCGGTTCCATAGCTAGTGTCCTCCTTGTCCCTCTCAGCTACAGCATTAAACACTATTCCAGTGTGGTGGAAACAGTCTTGAAT
GGTGGGCTTACCTCGCAGTTC