Description :
From Genome Similarity Track
Location :
Scaffold_60:57798- 64663
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_60-snap-gene-0.52COP9 signalosome complex subunit
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.221-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.11Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.23Pyruvate phosphate dikinase

Sequence
6865 bases(100 bases per row)
ACGCTCAGCAGCTCCGTCGCCGACTCCCGCGTCGATCCTGTCCAAACAATGGTCAAACAGCCATGAACGAGCTAGAAGATGGCACAGAAAAGCGTCACGT
ACGGCGCAGGAGGTCCACGAGCGGCTGCAGCTGATGAGGCCACGGCTTGGTCATCGCAGAGTGCGCAGCACCCAAGTCACTGTACCAACCCCATTCAGTA
CACTTTCGCGCCGTCGGAGAGAACCACTCGTACCGTTTCCACAGAGCCTTGCCGATCTCCCACACCGCACCCAACACCTCCGACGCGCTCTTGGTCGCAT
GATCGATGCGCTTCCACAAGAACCGCGCGTCATTCCTGACAAAACCACCGCCCAGAACCGTCATTACTCGTCATCCAGTCACCTCATCATCGATAGATCC
ACGTACAGGTTCTTGGAGAGCAGCACGACGAGCAGGTACGTGGCGTAAAAGTCCGGCGTGAGCACCGCTGGGTTCGGATTGCTCGGAACTCCAGCGTCGA
TCGCCGGCGTGGCCGCTGCCGCCACGAGCTCCAGCTCCTCGAAGCCGCGCTTCAGCTCCTCCACTCTCTCGCCGTCGACTGAGGGCTGAGCCTCCGCGAT
CTGCAGCAGCTCCGCCAGCAACTCCGCCTGCGTCCGCTCGAGTCTCGCGACCAGCTCGAGCATGTTGTTGTCCCTGATGTTTGCAGGCTTCTTCGGAGGG
TACAAAGGTTACTGTGGATCTGATGTCCACTAAGTACGGCTCTCAGCTAAGTACGATGTACATGGCTACAAACGAGCTCGGATGCGATCAAAATGTGACG
CTATGGCTTGGCGCGATCTACATGCGATCTTCCGGCTTCTCACGAACAACAAGCTCCATGATTCGTCGTTTTGATGTGGGAGATGACTTGGAGCGCGAGC
AAGAGCGACAAGCCTCGCAGCAGAGCGAGCGAGAACATATTGAGAACTTTTGGGATCTGTTAATCAGTCGAAGTGCAGCTTACGGGTTCAACTGGTTCCG
CTGGCTCCGGGAGTGCCACATGCACAGTGACAAGCGAAAATGCTAATACAGCGGTGCGAAGTAACGACCAAGAGCAGAGAAGTGGCCAAGATCAACCAGC
AGATTGATCATCTATCGTGTGGGAGTCGTTAGTTGTCCTCTCTCTCGAGCACCTCGACGAGTCTGGAAAGTGTCATCTACTCGGCAACCGCGTCGTGCTG
TTTGTTCCACGTCACCACGTCGTCGTAGCGGATGTTGCCGCCGAAAATGTCGAGAGCGCTGCCGATCGACAGGTCCACCCTGCCGCGACCCACGCGGTCC
ACGACTTCCAAGTCCGCCTGTATGATCACACCAGTCAGCTTCGCGAATACACACCCGAGACGATACATTCGATCGAAGACACGTTACCAGCGAGCTCGCT
CCACCGGCGTACGTGACAGGGATCGTACTCCACTCGGCCAAAAGCTCGACGAGTTCTTGCTGTTCATCGACAAAACCGATAGTCGGTTTTAGATGCAAAG
CAGCCCTGGATCCCATCGCCTTGTTGCCCACGTACCTGGATGCCACAGCGCTTGCCCTCGACATCCACGGCGTGTACGAGGAATTCATCGCAGTAGTCAG
CTAGACGGTGCAACAGCGCCTCGCTGCGACAATAGTTAGCCACATTAGTTCCCGAGCTGAGTGGTGGCAAGATACAAACGTACTCAATCGAGGTCGACGT
GAACGTCTGCCAGCGGTCAGTCATGACGTAGAACCGTCCATCCTCGGCCTTCTTCCGGCAGCTCAAGTCCAGAACCTGCAGGCATGTAGCGTCAGTATGC
AGCAGTCGAGCCAAGCAGCGAGACTAGTGTACCAGGTGGTCCTTGCCGACGAGCGTCTTGAGCTTTTTGAGCCGCTCAAAGTCGATCTGGCCGTCGCGGA
ACACGTACGACGTCACAATCACGTGGCTCGCGCCGTTCTCGATGTAGAACTGGCAGTTGTCCGCGTTGATTCCGCCTGGAAATCCAATCGTTGGATACCC
ATCAGTCTCGGTATCAACTCGGTGCTCTTGGCAACACAACCCTCACCGCCGATCTGCAGTCCGCCAGGGTACTCGCGCAGCGCCTCCAGCGCCGCCTGCT
TGTTCGGCTCGGAAACGCCGAGCATAATGACGTGTCCTCCTGTCAGCGAGTCCCGCTTGTACATTCTGTCGTGGTCATTGCTTGCGATTAGCTCTTGAAC
GCTTCACGACAAGGTTACACTCGCTTTAGGCGTCACCTGGCGAACTCTCCGGCGCTCTGAGAGGCCACAAAGTTGGTCACGGGAGCCTCCGCACCATCCG
TGAGCGTCGATCCCACGATCTGCTTCACCTCGCCCGCGTGGATGTCGATACACGGCCGGAACCGCATCCTGTCACTAGCTTCCTCAGCACCTTTGATGCC
TGTCACGATTTCCGCTGGTGGAGACATGGTTACGTCGAGCGAGGGTTACGCGCATACCCTCAGCCGATTAGGGTACACTTCAGAAATAGCACGATCATGG
CTACACTTTCATCATTGTGCACTCACTTTGGCACCAGAATGAGCAGCGACACCACGGCTGCGACGGGCGATGCCGCGGCCGAGCAGCCGAGCGCGTTGCA
GCTGTTGCGCGCGCAGCAGAATGCGTACTACATCGAGGCAGTGCAGGGAGCGCTCGAGGCCGAGGAGCGCCGCAAGCAGCGGCTAGCGGGTGTGTCGACC
CACCTGGAGGCAAAGCGGCTCGAGAAACAGTTTGCGCGTGAGCGCCGGCAAGACAAGGAGCGGCTCGAGCACATCCAGGAGGATCACAACTTGTTGCTGA
AAGCCAAGATCGCCGAGTGGAAGGCCAACGGAGGTGTGGTGGCGGCGCCGGCTGTGACAGGTCGAACCACCGCGAGATCGACCAAACCAGCGGACGACGA
CAAGCCGCCAGTGAAATTGACCAAGGAGAGGCTCGACAATCTCTCAAAGCCCCGAGCGACCGCTACTTACGAACAAGGTATGGTTCGCGCTGCTGGCAGA
GCTGTATTCGATGGGTGAGGAGGTATTGACGAGTTCTCGTGCAGGCAAAAGACCGTCGAGTGCGGCTCGAGGACAGGTTGAGACGTCCCAGGACCTGGCG
TTCTACAAGGCCCTATACAAGAAACACGACCCAACGCGACTTGCAGCCTCGTCGTCGCTACCGGCGCTGAACGCGGCCAACCTGCAGGCAGTACGTGCCT
TCCACGCGCCTTGTTGATGGCGACAGAGCAGGCTCACGCTACGTCTGTTAGATGTCCGAGGTGGATCTGCTGCACCGCCAAGCGAACCTGCTCACGCAGC
TCCACGGCGTCGTCTCGCTTCAAGAGCGGATCATCATGGACGACCAGTGCACCATCCGCTCGTCGGTCTCGAGCTGGAAGTCGAGTTCGACTGGGACGTC
GGCCAACAATCGCAAACGGTAGATTTAGGTCTTCATAACTGGATATGTATTGAACTTCTTTCTCGATTACAAAGGTCGACTTGATGATGAGGATGCAACA
TGCTAACAGACAAAGAGATGAAGACATGCAGCGGCAGACCAATGCTGCCAGCGATAGGCACAGTCACCTTTGCTTGAACGAGCGAGCGAGCGGCGCTGTT
GTTGGAAAAGTGGACAAGGCGTCGAGCGGCGGCGGCGAGAGCTTCGCGCACTCTCAAGCCCGAGACACGCCCGACTGGAGACGCAGCGACGCGCCACCAA
CCGTCTGTCTGTCTCTCTTACGCGTGCTGCAGCTTGAGCGCCGCCTGCGCAGCCGCGAGACGTGCGATGACGACGCGCAGCGGGGAGCACGACACATACC
TGAGACCGACGGCCTCGAAGAACTCGATCGACTTCGGGTCGCCGCCGTGCTCGCCGCAGATGCCCAGCTCGATGTCCGGTCGCGTCGCGCGGCCGCGAGC
CGCAGCAAGCTTGATGAGCTCGCCGACGCCGACCGTGTCGATCGTCTCGAACGGGTCCGTCTCAAGGATGCCGTGCTTGACGTAGTACGACAGGAACTTG
GCCTGCGCGTCGTCGCGCGAGATGCCGAACGTCATCTGCGTCAGGTCGTTCGTGCCGAACGAGAAGAACTCGGCCACCTCGGCCAGCTTGCCAGCCTGCA
GCGCGCCGCGCGGCACCTCGATCATCGTGCCAACCTTGTAGTTCACCTTCTGCTCGCTCGCGCCGACGATCTCCTCCACCACCGACTTGACCAGCTTCAC
CTCCAGCTCCAGCTCCTCGAAAGTACCCACGAGCGGGATCATGATGTGCGGGTGCACAGCCACGCCGTCGGCCGCGACAGCCACCGCGGCGGCCGCGATC
GCCTTCGCCTGGATCTTGGTGATACCCGGGTGTACGATGCCGAGACGGCAGCCGCGCAGACCCATCATCGGGTTCGCCTCCTTCATACCCGCCAGACGAG
CCTCTACCGTCTCCTTGCTCACGCCGAGCTCCGTCGACAGCTGCACGCACAGGTCGTCCAGCGCCGATCCCTCGTGCGGCAGGAACTCGTGCAGCGGCGG
GTCCAGCAGACGGATCGTGACCGGCAGACCGTCCATCGCGCGGAAGATCCCCTCGAAGTCCTGCTGCTGGAACGCGCACAGCTCGTCCAGAGCCTCCTGC
TGCTGCGGCGAGTCCAGCTCCACGGCCGCGATCATGCGACGCACCGCCGCGATACGCTGCGCCGAGCTGAAGAACATGTGCTCCGTGCGCGTGAGACCGA
TACCCTGCGCGCCGTTCGCACGAGCGTCGCGAGCGTCCTCGGGAGTGTCCGCGTTCGTGTACACCTCCATGCGGCGGTGCGCGTCCACCCACGTCATGAA
CTGAGCCATGTCGGCGCTCACCGTCGCCTGCTTGAGCACCTGCTCGCCCTTGATCACCTCGCCCGTCGTGCCGTTCAGGCTCAGGAAGTCGCCCTCCGCC
ACCAGCACCTCGCCGCCGGCAGTGCGCACGCGCAGCGTCTTGGACGCAGCGTCGATCATCAGCGCGTCGCAGCCGCACACGCACGGCTTACCCCACCCGC
GAGCCACCACGGCCGCGTGCGACGTCATGCCGCCGCGAGACGTCAGGATACCCTCGGCAGCGTGCATGCCGCCAACGTCCTCGGGAGACGTCTCCTCGCG
CACCAGCAGCACCTGCTCGCCGCGAGCGAACCACTCCTCGGCGTCCGCAGCAGTGAACACCACCTTGCCGACCGCCGCGCCGGGAGACGCCGCCAGACCA
GAGCACAGCACGTCCGACTGGTACGCCTTCTCGTCCGCGAAGCTCGGGTGCAGCAGCTGGTCCAGGTGACGCGGCTCCACCAGCATCACGGCCTCCGCCT
CCGTCACCAGCTTCTCGCGCCACAGGTCCACCGCGATCTTCAGCGCCGCCGGACCCGTGCGCTTGCCGTTGCGCGTCTGCAGCATGAACAGCACGCCGTC
CTCCACCGTGAACTCCGTGTCCTGCACGTCCTTGAAGTGCGTCTCCAGCTTGTGCACCGTCTCGTCCAGCTGCTTGTACACCTCCGGCATCTTGGCCTCC
AGCTCCGCGATCGGCTGCGGCGTGCGGATACCCGCCACCACGTCCTCGCCCTGCGCGTTCAGCAGGAACTCGCCGTACAGCTTGTTCTCACCGTCCGCGG
GACTGCGCGTGAACAGCACACCCGTGCACGAACGGTCGTTGATGTTGCCGTACACCATCGCCTGCACGTTCACGGCCGTACCCTTGAGACCCGTGATCTT
GTTGATCTCGCGGTACTTGACCGCGCGAGGGATGTTCCACGAGCGGAACACGGCCTCGATGCCCATCGTCATCTGCTCCCACGGGTCCGTCGGGAACCGC
TGCTCGTGCTTCTCGTACACCGTCTTGTACTTCTCCACCAGCTCCTTCAGGTCGTCCGCCGTCAGCTCCACGTCGAATGTCACACCGCGCGCCATCTTCA
TCGCCGACAGCTCCGCCTCAAAGTCGTCGTGCGGGATCTCGAGCACCACGTCGCCGAACATCTGCAGCAGACGCCGGTAGCAGTCGTACGCGAACCGCTC
GCCGCCGCGCGCCGCCACGCCCGCGACGATCTCGTCGTTCAGACCGAGGTTCAGCACCGTGTCCATCATGCCGGGCATCGACACCGCCGCGCCGGACCGC
ACCGACACCAGCAACGGGTTGGCCGCGTCGCCGAACGTCTTGTCCACCGTGCGCTCCATCAGGTGCACGCCCTCGCGGACCTCGTCCATGAGGCCGTTGG
GGAGGCGGCCGCCGACCGCGTAGAACTCTTGGCACACCTCCGTCGTGATGGTCAGGCCGGGCGGCACGTTCACGCCGCCGCACGCCATCTCGCACAGGTT
AGCTCCCTTGCCGCCCAGCAGCTGCTTCATGCTCGCGTGGCCCTGGCTCTCGCCCTTGACGAACGTGTACACACGCGGGTGCGCCGGCATGGTGAGTTGA
TGTGTGGGGAGGGATGAATGGATCGCTTGGAGTGACTGCTCTTGACTAGTCGAATTGAGGAATGAGCGGTGGGGGGCGGCGTCTCCGAGTCGCCTTGCCG
GGTCGCCTTGGTCTGTGTGCCGTGTGCCGTGTAGTCTGTGACGTCTGTGGCGTGTGGCGTGGGTTGAGCACCCAGGTGAGCAAGCCGAGATCGATCGCCT
TGAACAAGTGGCTTCCCCGGACAAGCGGCAGTGGTCGGCGTCACCGCCACGCGCAGATCGCTCGCGGCAGCAACGGGCGTGTCACGACGACCCAGTGGCT
GCCGCGATTTCGAACAATTGCGGACACATTAGAATAACGATATAAAGCGAAAACGCAGGTGTTATAATGGATTTGGCGCATCAAAGTCGACGTCAACCAA
CACTAAGTCGACTTCAACTTGCAGTTCCGGCGGCGGAGCGTGCAGAGACAAGAGCCGTTGGCGCA