Description :
From Genome Similarity Track
Location :
Scaffold_11:57795- 59112
Sequence
1317 bases(100 bases per row)
GGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTTTTAACGATGGCACCCGTTGCCGATCGAAC
TTCCAACATACTTCGAGATGTAACTATCTCCTCGAAGTCAAGCCTTGGTAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCATAATCTACCAAAGCC
CGGAGAGAGCCGCTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGTGTGACGAGGTCGGTGAAACCTTTTACGCCCAGGTGTATAGCGATAGT
CCAGAAAGGGTAGACGAGCAAACCTTTTTGGGAAGGTAAACCCTGAACGCAGATTTCCTTGAACGCAGGCTCTGGGAATAAATGCGGCTAGGGTAGCGTG
GCGCCTTGTGAATCCCTATCGGTGTCGTTTATCTTCGGGGAGCCTGGATCGATCACCAGTTGAGTTGGCTGTGGGGTTGAAAGCCTTGAGTTCGTTGAGC
GTAACGTTCACTTGTCTGAACGCACTTCTCCGAAATGGCTGAAGTTTGAAGCGTGAGTGAAGGATCAGGGTTACTGTAACGGGGTTACACGCACAAGTGG
CTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTCGAGGTTTGAACACTTCCACGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACG
ACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAATGCAGCATCTTTTAGCCAATGAGTGACATGCATAGCATTGGAATTCTGCCA
ACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAGCATTAT
TTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGT
AAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTATCTGAGTTCGTACGTCATCGCACGAACG
CGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGAC
CCAGAGTGGGAAGCTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTC
ATCCTGAAGGAGCAACG