Description :
From Genome Similarity Track
Location :
contig_42:577922- 582696
Transcript NameFunction/comments
g7786.t1hypothetical protein PHYSODRAFT_329696
g7787.t1conserved hypothetical protein
g7788.t1hypothetical protein
g7789.t1conserved hypothetical protein

Sequence
4774 bases(100 bases per row)
ACGCTCCGGCATTGTTGCAGCTGATTCCGTGCTTGCTGGAGAGATGAAACTCGAGTCCACCCGACGCTCTTGACCTCCTTCTCCTTTGTTTCGTGCATCC
CCACCCACCAGCGCTGAACTCGATCCATCGTGAGCAGCTTGACGAAGGATTCCTCACTGAGGCTGGCCGTTAGGCATCGCACCCTACCCGATATCACTCG
GCGGTGTTGCTCTCGTTCTTCGGCACTGAGCTCAAACCATAAACGCCCTCCCTCCCGTCGACGATCCTCATCAAACTTCTGCACAAACAGCACAAAGTTG
CGGATCTGGTTCTTCATGCGATTGACCGCCGTGGAGGAGCGAACGAATGAGCTCCGCCGTGAAAACAGAGCGTATACCTTGGCGTGAAGCGTCCCCGTAC
CTCGCTGGCAGCGCAGCGTAGGGTACTTCGCCTCCACGTCGCTCCACGCCTGAACGAGGACGTCGACTTCGCTCCTAGTCCACGAGGTTACGTTCGACAT
CGGAGCTCGATCTGCGAATTCCTAACTGGCGGGTGCCTCGACACGGAAATTGACGGCGTGCTGCACCGTCCCAAGCGTAGGAAGTCAAGTCGGAATAAAG
GTCATATTAGAGGATGGCAGCAAGCAGCGCCTCGTGCGCTTGATACCCTTATGAACGCACCAGTCCTTCCCAATGGTTACTGATCGTTACGATCTCGACC
GGGAGCAGAGTTGCCGTAGCAGCGCATGGAAGTCCTCTCTCTCCTGCTGTCGCTCCGTGTGCATCTGCGCGAATAAATCCATGAATTGCTCCTGCTGCTT
GCCTACCAGTGACTCCATGAAGGGCACGTTCTGCTGAGGGTCTTCAGGTGGCGTGCGCTGGTGCAAGATGTCCAGTAGCATCGCTTGGTTCTGCTTGCGT
TCCTCCATTCGCTCCTCTCTGAGATCGTGCATGAGCTGCTCGAAGCGTGCGTTTTGTGCCTCGAGAAGCGACTCGACCACCTTCTCGTCTACTTGAGGCT
CCTCGTCTTCATAGACAGAAGGAGGTGGCAGTGTGGCGGGGAGAAGAACGTCCTCCGGGTCGGACACTTCATCGTCGTCATGGGACGGAGAGAGGCTGGG
GGAAATGGCCGGCGAGTCCTCCGACAATGCCTCGGACGACACCGACGGTTTCCGCGCCTTCTTCGGGGTCCGCTTCCGCTTCCGGCCTGTGATCGCCGCT
AGCACCTCCTCCTTCTCGATGATGACGCCGATTTTGTGGTACGTCTGTCGGTCGATCTCGCAGCCCACGCGTTGGCTCGACTTGGGGCTCACCAGTTTCC
GCTGGAGACGGAACCGCTCGTCGAAAGTGAGCTCGAACCAGTCTGATCCGTCAAGAGCCTCCAGTCCGACCACGCAGCGCGTGATGAAATGGTAGGACTG
GATGATACACCGTCTCTTGGCTGTGATGGACCCGACCGTCGTCTCGCTCGATCCCCCCATCGCAACGAACTTCTGTCGAATCAACCAGTTGGGCAGCTTG
ACCGTCTCACTCGGTTCGTTTCCGAGGTCGAGGAACTCGTCCACTGCGTCTTGCCACGCGTCCACGAACAGCGCCCAGTCTTGGGTGGTCCACGGCTTGG
GGGCGTCCTCCACCGCCTCCTCCATCTCGGTTCCGTGTCGTTCTTCTTGCGCTTGGGTTTCACCACCTTTTGCTTCAAGGACCCACCCCCTTTCCCCCCA
CAGACGTGGTCGAGTTGGCGGAAGAGCTCGGGACTCACGACCGTCATGCCCTTCTCCTTCTTGTTGGTCGCCCGACGCAGCTCGTGCTGCTCGGCCGCCG
GGAGTTCAAACCACGAGGGGGACCCCGTCCGCCGACTTTTCTGGTTCGTGTCCACGATGAGGCGGTACGACATGCACAGGCGGTGGTGCTGTCGGGTGAC
CGACGACAAGCTCCGTTTACTGCCGCCCGAGAGAGCGCAGAACCGCGCGTGCAGCGTGGAGCGCTCCCCCGTGGACAGAATGAGTCGGTCCTTGGGGTCG
TCCACGACTTCTTCCCAGGCTTGAACCAGTTGCGACAACTCGTCTTTGCTCCACGCCGCATTGACTCTGGCGGTCGAGCTTAGTGTCGACATGTTGCCCA
CTCAATTGGGCCCTTGACGAGGTGCTGGGGGCGCTCGGGGACGCTCTGTAGCGCTCAGGGGCGTGCAGAGGTCGGTTTCCAGCCGTCGAATTGAGATTTC
GAGGACTGTCGCGCTCACTGGCTGGGGATTTGTCGAAAACTGGACGGAATCACTTGGTGTTTGTATGGCTTCCAAACTTTATACCCGAAATTTGCCGGAG
AAGGTGGTGCAACATCGAAATTCAAGCGCTACTTTGGTTTACCCAATTCATGCAAACTGCAACTATACTTGCTCGGTCACTCCTTGTGCTCCTGGTCCTG
GCTGCCCACGAGGCGAGGCCCACCCAATTCTCGCAGCAGCATCCGAGCTTGCTCGCGCTCCTGCGACCGCTCGTCCTGCAGCTGGTTGAACAGCCCCAGC
ATGTGCTGGCGCTGCTTCTCCACCAGCGCTTCCACGAACGGAGCCGGTTGATCGGATTTCTGGGCCGACGCACTGCGCAGCTTGAGCGCCTCGAGGATGA
TCTCCATGTTGTGCTGGCGCTCTTGTCGCCGCTCCTCCTGGAATTCCGCGAGAAGTGCCTCGAACCGCTGGGTCTGACCGTCCAGCAACCGCGACACCCA
CTTGGCGTCACTCACCCCCGTACGACGGCGCTTAGGAGGCGAGCCACCGCTACTTGCAACGTCGGCAGGGTTCACCTCGCGACTAGATCTCCGCGCTCCG
TTCTTTGCAGAATGAGGACGTCTAGACACCACCAGGGCCTGTGAATTTGCTCCTCGACTTGAATTTTCACCCCTGCCATTTCGAGCAGGTGCAGCCCAGT
CGGAGGTCTCATCTTCCGACTCGGACGTTCTTTCTGCAACCACAAAGCCACGAGGAGGGCCACCGGCATACTTTCCCTTGCCTAACTTCTTGCCTACCTT
TTTCCGAGGATCCCTCGCACCTTTTGCCGTTCGTCCAAGAAGCTCATCTAGAGTCACCGGGGCGCGCAGTGCACTGGCCACCGGCGTTGAAATCGCTCGC
TGCGCCCGGTCAATCTCGCCAAGTCGCTGATACACCTCTTTCTCAATATAACACGCGTGCTCGTGGTGGTGTCCGTGCATCTTCTGCAGTTCCATCCTCT
CGTCGGGTGTCATGCCAAACCAGTTGGGGCGCTCACTCAGCGACGCCAGCGTGCGGAGCACTCCACGCAGCGACCGGAACGCCATCATGATGGCGTGTTT
CTTGGCGCCGGTTGACTGGTTGGTGCGTGGCGTTTTGTCTCCGCACAACTCCACATACCGCTGGTGAATCAGCGAGTTCAACCGCAGGCCCTCGTTCCGC
GACGCGAAAGAACCTTCATACCCGTTATCAATCAACGTCGTCACGACCCCATGCCAGGCCGACATGAGGAGTTGTTCGTCTCGTTTCGACCACTTGGACG
TCGCCTTCCCCTTGGCTTTCCCCTTTGCTTTGGGCGGGGTGTAGTCCAGGTCACTGTCCTTGCGGCTTCTCTTGGTCGGTGCGTACTCCTCCTCCACCGA
CTCTTCGTCCGATTCGGACGTCGCTTCCCTCTTTGTCTCCACCTCAATCTGCTTAGTGTTTGTCGTCCGAACGGGGGACGACGGAGGTGACAGCGACGGT
GACAACGTCGGTGGCGCCTCGTTGTTGGCCCGGAACATGGGCAGCCCCGCCAATGCCTCGGCCGCCGCCTTCATCTCGTCGGCCATTGGGGGCGACTGCA
ACTGCTCCGGGGGTTCGCAGATCCGCGCAAGGTACTGGAACTCGTCCTGCGTCACTTCCGCGAGGTCCCCGAGGCGCCCGTTCATGCGGCGCAGGTCGTC
CTGTTGCTGCGGCGGCAGCTGGAACCACGTGGGACGGCCGGCGCGCGCGCTCTCGGCGTTGAATGCGCGCAGGAACAGGAAGGTGCGCACGAGTCGCTGG
CGCTGTGCTTCCACTTCCTGGATGGCGATGGGTGCGCCGTCCCGCGGACGCAACGCGTCGAACCGCGCGAGCACCTGCTGCAACTCGTCGTCCGTGAGTT
CGTCGCGGTCGCGAGGAGCCGCTATCGCCTGCTCCCACGCCTGCAGCAGCGCGAGCAACTCGTCTCGTCGCCACTGGACCATGTTCGTTCGACTTTGGTT
TCTCTCGCCTGAATCCTAAGCTCTCGATGGTTTATTTATTTATATGGCGAGTTGTATGAGACTTTAATTGACTTCGAAGGTACTGGCAGTTTTTAAGAGC
TTGCTGTGACTTTTTGACTGGCGATGGGAGATACTGCGAGTATCGTGCAGGTGTTCGACGAGGGCGAAGTGGACAGAGTGGAGGAGTCCATCCGCGTGCG
CGTGTACGACCAGGACCTGAACTTGACCCTGCTCATGGTACAAACTTCGTCAAAAATGCCCGTCGCCATGTCTGACTTGTACGACCACTTCAATGTTCAT
TGCTACAGCAAGCGGATGAGCTCGCTCCGTTTTTCCGGCGCCGCGTGGGGGGCACGTTGCTGTGGGACGCCGCTGTGCACTTGACGAGGCGGTTTCTGGT
CGAATATCGCCAGGAATTGGCGTCTTCGACCAATTCGCTGCGTGTTTTGGAACTCGGTGCCGGCATGTGCGTAGATGCTTGTCACTTGTTGAGAAAGCGG
TGCTGACAATGGTGAGTTGGTGACATTTTGACACAGTGGCGTGCCCGGTATGGCGGCGCGTGTTGCAGGGGCCA