Description :
From Genome Similarity Track
Location :
Scaffold_663:5778- 7198
Transcript NameFunction/comments
Phymu_g11428hypothetical protein

Sequence
1420 bases(100 bases per row)
TTATTGTGTTGGTGCCTCCCCACACCCTCACCACCGGTGCGAACATACTGCAATTCCAACTCCAAATCTTCGTATTTGCACCTTATTTCACGTTTATCAG
CTTCCAGATCCCCATTCAGCCGTAGTAGCTCCGAGACACGGGCTTGAATCGCTTCCAGTTGACACATAAGGTCTTCATTGAGTGTCTTGGTCTCACTAAG
CTCAGCTTGCAGCAGAATTTCCCTCTCTTTCGACCCAGTAGCCTTCATAGCAGCCTCTAGTTGCCCCATGAGCAAACGTTCTCGTGTTTCCAACGCGTCA
ACACGGCTCTTTAGCCGACCTACCTCGCTGTTATTGCCTCGTTGCTGTCTGAGATCGAGCGACGGGAGTTGCACTTGATTATCCTCCAAGTCTTTCTCGA
GCTGTTtacggcgctgctgctcaaccTGAATCTCGTCTTCCAGAGCATCTAAACGCTTTCTGAAAGCCTCCCACTTCGTATTCCGCGCTGTCCAGTCGCG
CTCGTTTATCTGCACTATCGCATTCTCCAGGACTTGCACCTTATCACTTGATTTCTCTCGGATTATTGACAGATCTTGGGCCtttttctccatctccagt
tCGAGTCGTTGATTCTTCAAgagcgtttgctgctgtgcttctgTGACCAGGTCGTATTGCACGAGAAACTGCTGATAAGTAGCCTTAATCTGCATCAACT
GGTGTTGAAGCTCTCCGACGATTGCATGATCTTCTGACGAGGCCATCAATTCACGAAGCTGTTCTACTTCCTGCTCTCGATTTCCTTGCTCCTGAGTAGC
TCGTTTTGTCAAAACGTTAGCCTGGGACGCAGCAAGCAAAGCGATATCCTTGTACTTGGCACATTCAAGCGTGAGACTCTCATACAGCTGTTCCACTTCG
TTGATTCTCTCGTACAAAAGCTTGTTTTCATTTCGCAGCTCGTTGTCCTCCCCAGAGTCTTCGTTGGTCATGGGTGATTGTGCCAATTCATCATCGTGAA
ATAGTCGCTGATAGCtagcttcttcaagctccttCACGCGTTTAATTTGCATGTCCAGCTCGCTTTCTAGTTGAGTTATCCGACCTTGCAGAGTTCGTGT
ATCACTGCCCGTTTCCCCAGCACCTTTGGCTTTTTTCTCTGCCCGCAGTATCGTAATTTGGTGTTGGGCTCGGCTCAGTTGAGTTGGCaactcgtacagc
tccagaTACTTGGCATGCATCTTGGCATAACTTTGGTTTACTGcgttgtacttcttcaatACAACAGCCATGGTTTGATGTTGTTTGTCAGCAAACTCTC
GTAAAACACTCTTTTCCAAAGTTTTCTCCATGCGCTCCATCATCTCGTCAGCACCCTGCTTCCACGTTTCCAGGTACAACACCCGGTATTTGAGCGTCTT
TTCCATCTCACTCCActcac