Description :
From Genome Similarity Track
Location :
Scaffold_216:57758- 63750
Transcript NameFunction/comments
Hyaar_Emoy2812750hypothetical protein

Sequence
5992 bases(100 bases per row)
CAGAAACGTAAAGGCAACCTTCCGAATGTTTGACTCGGGAGCCGAAGTCTCGATCATCGACACCACGTTGATCGTAAGGTTGGCTGTGTCATAGATGAGA
TTCAGAAGCAGGAATGTGAGGGTATTGTAGAGAATTCATACGTATCAAAATGCCGCACGAAGGTGAAGATCAAGCTGAATGGACCACTAGTCTACTACTT
TATGTATGGGCTGGTGGACCAAGTGGGACATGAAGCAATTCTAGGAATGGGTGTTATGGTACCGGCCGGAATACACCTTGACCTTGCGGAAGGGACAGTT
TATTTGCCAGACGAAGTCAGAATTCAAGTGGATGGTTGGAGACCATCGTATGGGGCGAAGATTCAACGAACTGCCGCGGATGAGAAGCACTTAGCGTCCC
GGTAGATAACTCTGTAGAAGTCAACGTGGATCGGGGACCACTGCAGTCAAAATTATAGCTAACACGTCACCCACGCTGAGTATCTACGGCTATGACTGAA
CCTGGAAGGTTGGTTTACCTTCTCCTGACAAATCGAAGTGACCAAGAGGTGATCATCCAACGAGTGATACCCTTCGGACAATGGATGCAGGCGGATATGA
TACCGCGAACACCCGGGTATGTGTCCGTGGGGTCACGGCGATATCAGGAGTGGCAAACACTCGAGTTTGAACAAACCACAGAAGAAGAGGAAAATGTATT
TCCTGAAGGAGATGGGCCTTTGGTTGAAACCCATCATATCCAACTTCAACGCAAATTTTAAAGAGACCGTCACACGATAGATCAGAAACAACAATGGAAG
AAGAGGAAGCAAAGCTAGAAGGCGATTCACCGACATGTGATCACGCGGACAAACAAGATGACCTTAAAGAGCAACGATCGGGACAACCATGGTGGTTATT
AACGCGATAACCACATCTGGTAGGACTAGTGACGGGGATGACGGTGATGTGGTTGAAGAACCGGGGTCTGAGCAGCTGGAGCAAAAGAGTGAATCCGAGA
GAGGAATATCTATGCGATTGTCAGTGATAGTCGACTTGAACACTCTCCCGACGTGATCAAAGACGTCGCGATGGTTCGGGACCGGTCAGAAATACAGCCA
AGCTATTTTATGGGATAACTCACTTCCGAACCGATCAATGAGATGGTATTTGATCGTATGCAAGACCGGTCCACCAATCACCCAGACGGGATCTCTGGCA
AGAATTGTGAGGCACATCGACCGTCCGACCATCAGGCGAACCCAAAAAACACCGATTACAAGCGAGGGAGCACACAAGTGCTCGTCATACTATCACGAGA
GTGGAGTGTTGTTCGTGGAGAATGTTGGCCAACATATGACAGTCTTACCAGAAGTAGACATGATGCTAAGCGAGGTGAAAATTGAAGATATACAGGTAGG
CGACCCAGGAGTCCAATTGACCAAGGAACAAGAGGAATTACGTCAGCTGATCTGAAAGAAACGACACCCTCCGATGGGTAACGGAAACGCCCTCCCACCT
GCTGCGCGAGGTGTTACCTGCTATATAGATGTCGGAGAAGCAGCCCCAATCGCACAGGGAGTAAGGCCAGTCGCCCCGAAGTTCCGTGAAAAGTTGGCGG
ACCTGATCAAAGGGTTACTACCGGCCAAATTCGTATGTCCCTCAACTTCACCATGGACGTCGCCGATCGCAGTGATCGTGAAAAAGAACGGGGTGGATAT
AAGACTGTATATCGACTGCCGAAGTGTTATCCAATTGACGAGGCTGATGGTATATCCCATGCCCCTTATCAACGATTTGTTGCAGGATCTGGACAAAGCG
CTATTGTACTGTTTACTGGAGATGGCCAACGGATTTTGGGTTGTAGAGATGACGTAAAGAGCACGAATAATCTCTGCTTCTATTACGCCCTTAGGTCTTT
ATGGATGGTTACGCATGCCTTTCGGGCTGAGGAAAGCTCCGCAATATATCGGCGTATGGTGGATACTGCATTATATAGGTATCTTACGATCGGAGATCGG
CGGAAGTCAAGTGAATACTGGGTGTCTAAACAGATCGATGTGTTTACAGACGGAGAGCCAAACCCGCACCAAAGTCCTTCAGTTTTAGGACGGAGGTCCT
GCATTGATGACACTCTGATCCCAGCTTCATCCTGTACGTCTCTCCATCAAAAGGTGGACAGATTGTTGGAAGTATGTGATCAGTGGAATTTGTCGATCAG
CTACCTACCTAAGAGCGGCTAGGGACGAAACAAGGTTGAGTACCTCGGGCACGAAGTGTCAATAAGAGGAATAGAAGCTGACTCGAAGGATTTGGGGTCG
TCTGTCAATATTTATTTCCCCCAGACATTACGGTCAATGCAGTCCTTCCTAAGAATCCTGGACTACTACAGCCGGTTCATTGAAGGCTTTCCCATACACG
CCCTTGTCTCATGAAAATCAGCTTCCCTCAATTCGGTTAAATTGAGGGAAGCTGATTTTCATGAGACAAGGTGTTTGCACAATACGGAGAATGAGGGTTC
ATCCAGCTATGATCACGTCCGTAATACCCAGATTGATGATGACCGCGGGCAGCGACCTGCAGGTGATCATGATCATCAGCTAGTGACGATGAATTTTCAG
GATCAAATCAAAGTGAAAGAGTCCGGTGGAGAACATACTGGTTTCTCATCGTTGGGAGAAGGCCATGATTGCGTGCACCATGTTGGAAGCTAAAGTAATC
CAAAACCCAGTGCTAAGACATTTTGATCCAGACTGCTGACCAGTGATCGTGGTTTATGCTATAAAATAAGCGGTATCCGCAGCTTTGCTACAAGAACATG
ATGGAGTGAATTGGCCTGTTATGTTCACAAGTCGAACTTCAAACCAAACGAAATTAATTACGGAGCGGTAGAGAAGGAAGTTCTGGCCCTGCTCCGGATG
TTGGATATTACGCTATTGGTCGCGCGGGGTGTTAAGGTACTCACGAGATACTACACCTTCGCATATTTGATGCACTCGTCAGGTCTTAATGGACTTGGGA
GATGTACTACTTTGCTGTCGACTTTGACGTTGGAGATTATACGGTGTAACAAAGGGGAGGACGAAATCCTCGGCACCCTTGCAGCGAGTATTATATCGCG
AAAGGATGTGGATGAAATGTTGACTGCGATTGTACCACGGAAGCAACCGAGACAGACCATCAGTATGCCTTCTCCTACGGTCACAAATAGCGAAGTGCTT
CTGGTCGTCAGCTTTGACGGTTCAACACGTGTTAAGAATAAAAAAGGGCTCCCACAGTGCAGTGATATGAAAATTGCCCGAGTGGACAATTCTATCGGCC
GCGTCGCGTTTTGATGTTGGATTAACAGTGAAAGAGGCAGAATATCACGGGTTATTGCCGAGTTGCGAGCTGCCAGCGAAATAGACAAGGGAGAGAGTTG
TCATCTGTGGTGATCCCAACCTGATCATCAGGAAGATGCGGGGTGAAATTGATTACAATGCACCAGGGCTACAATCACTGCCCTCAAAGCCCTAGATCAA
TTTATGTCTTGGCCAACACATGAGTTTTTAAACGTTAAGCGCGATTAGAATCAAAGTGCGGATCAACTGGCTAGCACCGCTTTACAGATCAAAAAGGGCA
TGGTAATGCTAAATGACCAGGATTGCCACGATCTGAGCGCCATCAACCGACAGGACGAAATATTGATGCCACATGAAATGATCAAGTGATTAAGATAGCG
GCGATTACACGATCGACTATGCGAAGGCGTGAGGCGTTTAGGAATATACAAGAGAAGGTGGTACAGCAGATGCGACTCGACCGTATAAAATAGGCACAAG
ACGAAGAAGGTTGGATTGCTAACCTCAAGCTTTACTTAGTCGCAGATGTAACAGAGCTGGGTGCTGTATAAGCAGCAAATGCCGTGATTTCCCCAGACTA
CGTGTTAGATAAGGCGGATTGTTTTTTTTTGCCCGCGTTCGGCGATAAATCCCGATGATCGTGCTGAGCTCGTTCATCTGGTGATCCCGGAGCTACTTCA
AGATGATATTCTACACCATTACCACGCAAGTCTGGAAGGTGATTATCAAGGAGTGGGCTGCACGTATCACTGCGTGTGATCACACTTCAATTGGAGAGGT
TTGTTCCGAAGGGTGCGACAGTTCGTGGGGAATTGTTTCGACTGCTAAATTGGGAAGGAGTGTCCGGTGCTACGTGGAGAATCCCCAGGAAACATGCAAG
CTACGTACCCTTTTGAGATTATTGCAATGGATCATACACCTTCCTTGCCATGGTCATTCAAAGGAAATACTAAATTGCTTCTTTGGGTTGATTTCTTTTC
TGGCTACGTGATCTCTAAGGCTAGCTCGTCGAGAACGGCCCAAACGATTGTGGAAGGGTATGAAGAGTGCGTCTTCCGGTGATTTGGGGCGAGCGAATCT
ATTTGTCATGATCGCGAGCCTGGGTTCATGTCAGATTTCTTGCGCGCGTTCAACCGTATGCCGGTCCAAAGCAACTTGCTACAATGGCGTATAGACCTCA
GGCAAATGGCACCGCCGAAAGGATGGTCCAAACATTGACCAGAGCGCTCAAGATGTACGTCACTGATGTGGACCAACAAGACTGGGATGAGTACGCCGAG
CGATTGACCTTCGCCATCAATACAGCGTATGACCGAGTCCGCAATATTTATTCGTTCTATCTTATACACGGATGGGACCCGTGATCTACGTTGGAAGCAA
CCCTACGATCGCGTGGATGCACTAAAACACGTGATCGTGACCCCAGTAGATGGCGTTATCATATACAGCGACTGAACCAACGTGCCGGGCCACCGTAAAT
GACCGGTTAAAAGAAACTATTCAGGATCGGGATGATCAACACAACACTGATCAAGGGCAACATGGAATAAGCTATGGTAGCCAAGTGTGGTTGTATTTAT
ATCGAATGAAAGGAGGATATGCTAGGAAGCTGGCTCACATATGGCATGAATTATCCATTTCGGGTGGGGAACATGCAGTACGGCTGAAAGTGCAAGAACC
TCATACCGATTATTCTCGCTCGTGCACATACCCAAGCTGAAATTGGTACGAAGTTTTCCTGATCTACCTGTTGTACGGTTGGAGGTGGAGAAAAATGAAC
GATTGGATTTCGATGTAGCCCTTCTGCCGGAGGACAGTTAAAACGGTAATTTGGCTGAGAGGGAATATGAGGTGGACAGTATTAAATATGTGCGATTGGG
ACGTAAAATACGGTATGGAAGACCACACCGACGGTTTCTAGTATGATTAAAGGGTCATATTGAGGAATCATGTGTGTATGAAGCGAGCCTCAATTGGGGT
GCGTTTTTACAGGAATTTAAACGTGATCGATCTAATCGTATTTTTTTGAGGTGATGCAAGTACACGAAGACGATCTCAGAGGCTAGGGTGACCAGAGGCG
ACCGCGAAGTATGGTGACCGTCTGGTTCGTGAGCGAGCTGGAAATGAGGAGGAGTCCCATAGTTAACGTACGTAACTATGATGGAATGTAAAAGCGCAGT
ATATACAATGAAGGAGGATTTATTAGTTACGACTGGAGGTCACGACTACGGCTATAAACACCATGGTCCTTCATAAGAAACAATAAATCACTTCTCCACG
AAACTGTTCTTGAGGCGGTGGATGGACGACCCCGGGTTCTCGGCGATGGCCGTACGATATTGATTGCGGCAGGGATCTGCGGAGTCCGTCAAACGCAGCG
CGGAGACCAAATTGAGGATGTTGGTTTGCCGGCAGCCCAAATTCGGATGCCACAGGCATTTCTCTAAGCGTCCGGGAAAGTGCAGGAAGAAGGGTTTAGC
AAAATTTCGAGGTCGCAGCGACCCTCGATCAACTCCTGCAGCACAATCCGTAGCAATGCCTTCCACAGGGGACTAGATCGTGAACGTCTACGGCGTCTTC
TTCATATTAAACGCTCAACCCAGGATCCTTCGCGCGGTTTGGACTGACGAGAATTGGTAGCGCATGGGTTGAACCCATAGCGACTGGCGGTG