Description :
From Genome Similarity Track
Location :
contig_124:57747- 61400
Transcript NameFunction/comments
g11463.t1hypothetical protein

Sequence
3653 bases(100 bases per row)
GCCAGACGACGCGTTCGCGCGCGAGCCCGATTGCGGCGTGTGCTCCAAGTCCTTCAACATCCTGCGACGCCGCCACCACTGCCGAAGCTGCCACATCGCC
GTGTGCAAGGAGTGCGGGCGCAAGGCCGTCGACCGCAAGAAGCCCGTGCGCTCGCGGCCGCAGTGGTATTGCCTGGGATGCCTGGACGACGACGCCACGC
TCGAGATCACCGGCTCGCGGCCCACGGCGAGCAAGCGCCGGAGCTTCTCAACGTCTTCGTCGTCGTTCGCGCCCACGAACGCGCCGCAGGTCACTAATGT
GAGTGTGGATTTGTGCAAGTTGAAGTGCCTGTTTTTGACGGATTCTAACGGTTTTGTGCCCTCTGACAAATTGGTGCGGACTAGTTGACCAGCACGGCCA
AGTTCTGCATCGAGTGCGGCTATGAACTGCCGCTACGCGTCAAGTTCTGCATTGAGTGCGGCACGTCTGTGCGGCAGCAGGTGATGTCACCGGTGAGTGT
GGACGGCGTTGGCGCTGCAGAAATAGACAGAGGCAATCGCGGCTTCCGCGACTCACTGGGGACGAACCTCCTGGTCATTGACGAGCACAGTGGGTCGCCG
ACGGAGCCGACGGACGGATCAGAAGACGATGCGCCGGTTGAACAGGAGCCCGAGGATCACGATCCGGTGGAGAAAAAAGTGGAAGTGGCGGCACCTGAAG
GGGACGAATATACAGCTGCAAAGACCAAGGAGTATGAGGAGCTTGTGGCGCAATTGCAGGCGGAGAACGAGAAGCTGCGAACTCGTGTGGAGAAATTTAA
GCATAAGATCTCCGAAGCAGAGCGTCGTCGGCAAGAAAGAGAGGAGGAGCACGCTCGCGCAGTGTCAGAGGCAACTGCAGCTGCAACGGCTGCTGCGGAA
GCCCAGGCTAACAATCGCAGTGCATTGGGCCCGGCAACTCAGGCGGCATCAGTACCCGAAGCGGTAGGACCTACTAGCAATGGAACGGGTGTTGCTGCGA
AAGACCACCCGGACTACTTGAAGTTTTTCAAACTTCTGAAGATGGGTCTACCTGATGAACAGGTAAAACTGAAGATGGAGGCGTCGGGCGTTGATCCTTC
GGTCCTCGATGACCCAGATGCGATTATTGGAGGTGCCGCACCAAGTGTTGATAGTGCACCAGCTGCTCCTGTATCGAGTGGTGGTGCCCTGGTGAAAGAT
GACGAGCAGTATGCTAAGTTTTTCAAGCTTCTGAAGATGGGGATGCCTGCTGAACAGATCAAGCTGAAAATGACCGCTGGTGGTTTGAATCCGGACTTGC
TTGATACGCCGGATGCACCAATGCCCGGTTCCGCGGGCGCTATCGCACCAGCGGCAGCATCTAACCAGGTGATGAGCGTGAAAGAAGATCCAGCTTACGA
GAAATTCTTTAAACTGGTGAAGATGGTATGCCCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACACGCCAGATTGC
GCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACAGAAGCGGTGAAGGTGGACCCATCGGCT
TTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAGCCGAATGTTG
AATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGGACGTGGACGA
GATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCCCAAGGAAGTA
CTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTATGCTTTGGACG
GGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGATGTAAAGCT
GCTAGGAAATGTTGAGAAGTTCTTCCTTGATTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTCGAGAATCGCA
TCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACATTTTGGCGAT
CGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGTTGATCCTCGT
GTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAGCGAAGAGACT
GTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACATTGAGGGTGA
CAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTGCTATCAAGAG
CTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGGGCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAGGCTTACCGTCAAA
ATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGCACGAGGCCGAAGA
ACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTGGGCTGGGAAGCAT
TCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTTTGTGACCAAGTGC
GCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAATAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGCTAGAGGCGTTTGC
TCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGAGAGGGCGGGGTCC
TCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTGCTTCACAAGTCCA
TCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGCAGATCACGGCGCA
CGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTCGGAGAAACGCCAC
GCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGG