Description :
From Genome Similarity Track
Location :
Scaffold_1342:5774- 9528
Sequence
3754 bases(100 bases per row)
GATGACGTGGGTTCCATCGGCCATTCGTATTTAGGTCCAATAGCCATTTAACCGTGAAGACACTGGGCCTAAGTTTCAAGAAGCGGTCTTGATCTACCGA
GAGAGTAGTATGTAAACATCGCAAGTATTCTGAAGATCGAACGCGCGACATTGCCACATATATATGCTCGAATTGCCAAACCGGCGCGTTTTTGGATCCA
TCTAGTAGTGTTATAACGCGCTCAAACGTACTGCCTTGTGCCTTCCATACGGTTAACGCTAATGCAAGGTCAACGGCATGTCGATCATAGTGGATTGGTT
TTGAGTCCTTGCCAGAGTCATCAAGTTTTACTGTGTAATTGCCACGATTCGATTGAACCGTTCCAATTGGAATTACGACCGATTTTTTGTGCACTGGTCG
ACCTTCAGCATCGCAAACCCAAGTGGTTTCAAGATTCAATTCGTCAGGCCACTGATCACCATCGAGTAAGCCACCATCACGATCAGCAACCCGGACATTA
ATAAATTGAGGAGGGCCAGGAAGTTCGACAATCTTGCGTCCACTTtgaagagctgcttctgTTAGGCACATCGCTTcagtcatcgctgcttcatcatccC
AACTCATTGAATGATACCAACATCTAGTTCCATTTGTGACACCAAGCGTGACGTTCCCATTCGAGTTGTCCAGAACTTGACCAGGAGCATCGTAATAAAA
ATACCCAAACAGCTCTGGATGCTCTAACTCATTGTACAGAAAACCCTGAACAGCATCGTGAACGTTATCCAGCAGAGGTTTCTGCCAACGAAACAACAAC
CGTTTACTACGGTGTGCTAATTCGGCAACCATACAAGTATTTAGCACTGCCTGGTCGGTATTGCTGGTGACAAGTATGACAGACCCGTTCACCCAGCGAT
CGTCATCGATTGTATCTTGTTTTGTCAGCAGCCTAGTCAACGCAGCAACAATACTGCTAATGATTGGATGATAGTTTGCGTTGTTCTTGCCCCAACGATT
CTGGTTTGGATATACACTGGATAATATGCGGAATCTCTCAAGTAGTGCATGTTGTGTAGAACACCCATTCGCACGATGTTGTTTCTGTAAACTAAACACC
GTAAACAACGAAAACAGATACCGGGCTCTAAGCAGATCCGGATACCTtgtttacatgtacatgcattTACAGAGCGACATTCCTTTGATGACCTGAAGCT
GCCAGAAATCGCCTGTCTAAAACCGAGATAAATGTTATTTGCTGCCTTGTAGATCATAGCTCAATAAAAATGCAGCACGTACCAACAAGATGGATTTTCC
ACCAAGGGTCTATCTCGATTGTATAGTTCTCGGAGTCGTTTATCAAGTAAAACCAAGTGTTTTGCCTTGAACATCGATATTtcgtcaacaacaacgaggA
TAACACTCGGACNTGCCGTCAAGAACGGTTTTCACAACAGCGAACTGCTCATTCGACAACTCACACGGCGCAATCAACGATTCTTGGCCAAGCGGGTCAA
ATATGCTACCTACGCCATTGGTTTGCATAGGTTCTTCCACATTATCGTCATTATTATAATCGTGAAATTCGAAAGTCTGAATTGAAGCAGCAATACTTGA
AAAACTTTGTCCGTGGCATCCAGGCATATCTGAAGCTGGAAATATTGGATTCTGTAACGAGGGTAAAGTAGGTGCTGTTGAGGTCTCTTCATCTGTTGCA
GTATCCTCCGCGTTTATCTGTAAATACGGCTCCGAAAGTCGATTTTACTGACGCGATGCCTGCTCGTCTTGTAGCCGACCCGATCGCAGCACGTGTAAGC
AACTCATACAAATCCCCACTAGATGAAATTACCCCACAAAATTCGGGGTCGCCGTTGTATGATGTTCAGCTGCGGACTTGTTTTATACGAGCCGGAGTAG
CTTCCCAGTAATAAGCTCCCCTGTTTCTCCAATCGGTAGCAATTTGTTCGTTGGTATTGTTCCGATGCCCTTTTTTCAATACGTTTCGGATATACCGACA
ACGCTCCCTGTTTATCAATGGTGCCGAACTACGGTCCCATGCATCACACATACTAAGTAAtcctgctgcatcgagtgACCATTTCGAACCTCTTGAATCC
CACTCTGTGAATGTACACAACAAATAACGACCCAAGCTATCACGTTTTTCCTCAGCGCGCGAACTTTCAACGGAATTACTCCATGTTGGTGGCGGATCTC
CCCCAAATGTAGCAGTTAACATCTTCGCTCGTATAAATCCGTGATGGGTCTTGAATAGTGGGTGTGACGAGGCAAAAGAGAAACCATATCTAGTTGGTCT
CCCACGACACGTCTTCTTGGTTTCAGCCTGCTTCTTTATCGGAAGAATGTCCACTATACACTCAAACTCTAACGGGAAAATTCNGTGGTCAGCATCCCAG
TTTCCACCGCGTAACTTCTTCACATACTCAACAAGTGGAAGTGGGAATACATACCAAAACGAGTCGCTTGAAATAAATGATCGGTGTCCGGTTATTGCGT
GAACCACTAATGTGTGTGACCACTTATCCGCTCCGGAGAAGCTGTTCATGGTTCTCGCTGCTAAATATTTGCCAATACGTAGCTCCGACTGTGAATCATC
TGCTCGACTTGGATAATTTTGATTATGAATTGCTGCACTTAACAACACCAAAGCTGCCCCCTTAAGTGGAGCGTCTTCTTTTGTCATATAAGCTTGCTGA
TATCCCTCAATCATATTCCCCGAATCTTCACCGTTAATCACCGACGCGTTCGTATGCGAGCATGTCAGTGCCGCAAGAACAAGATTGGTTTCTACCATCT
TATTATCCATTAAAGGCCGCTCAAGTTCCCACAATAAAGGCCCTTCGCAATGCTGGTGAAAGGCTTCGCCGGTCAAGTATGAATATCCTTTGTCAGTAAT
CCAGAGGACGTGAGCTTGCAGTGTGTGACCTGCGACAATAGGGTGGGAACCGGTACGCGTGTTCCCCTTACGTTCACGCACGACCATTAGAGGACAGGTG
GCACTATTATGGACTCCTGACGGCCTAGCTAAGCGGCACATATACTTTCCACGTTTTCCTTTGAAGCAGGTAGATGTGTGTGAGTGGAAGTTTGTTGTGG
CCACACGCATCTGCTCAGCAGTAACAAAACCAGCGAAATTGAATCCAGCATCGGGTAGTGCAATTTGGAATGCTTTTGGCAGTACACCAGCTTGAGACAG
ACATTTTCCCCTCCATTCATGAACGGTTTCTTTTAACGTCGTACAGCACACAGACTCGAGCAAATTCGCAGCACGTTACAGAGGAAAGGTGAGCACATTA
TTCGCGATAAAAGCGCAGGATTGAAATTGGATCCGTAGAGAGACATATGGATATGGAGTCTTCCATCAGCTTGAGGCTCAACTACGGCTGCATGTGCAGC
TAAGGCTCCAAAaggtccagcttctcgttgaccGCAATCGCGTGAAATTCTCGTGTCGCTAGCACTTTTACAGAGTAAAATATCGCTATATAGTTGTCTC
ACACACCTTTCAAATACGCGGACTGATAGAGCAGGATATATATTGGAAACAACTAATCTGCACCGAACACTCGATCGAACATAATCTGGTAAATCCTCTT
GGCAGCATTGTTTTTGTTGAAAAATAACGTCAGTACGATTCCACGCCTTTAGGTCACGTAGTGTAGCGATACGATGAAATTCAAGATCATAATGTTCGGG
AGGGGCAATAGTTACCCAGTGTTGCGGTATTCCATACCGTGCTCGCAAGGCACC