Description :
From Genome Similarity Track
Location :
Scaffold_12:577369- 596710
Transcript NameFunction/comments
Phyra_75420Dynamin family protein
Phyra_75421elicitin-like protein SOL2C-D-E

Sequence
19341 bases(100 bases per row)
TTGATCCGATGACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCC
CGAGTGGCAGGCACTTGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGATCCTGCTGGAACTTGTAGCCTAGTG
TATTGGTAGCTTGTGGTGTAACTAGCAAATTGAAGAGTGAGAGATTTGGACAGTCGTCACCATCCATCCTTCTCAATGAAAGTATGAAGCCTTCATGCTG
ATGGCAGCATGAAAGGGAACATGTAAGGCAACCCGCGATTCCACTTGGATCACTGGCGGCCTGTTCTACAAGATCCATGAAAGTTTGGTCAGAGCCAGAT
GTCTGGCTCTGCCATCGCCAAGGAAGCACGCTGACCTTGATGCACCAGGATCAGGCGTAGCTCCTTCTGTGATTGACCTGGTTGCATCAAGTCGCACACT
GTCTATTGGTCAAGTCTTGAAGTTCACGTCTGGCGGCGGAAGCTGGCTTGATCCAGAATCCACCACAACACCTCACCATGCAAGAGCAAGAAATACTCGC
CTTGGCGTGAAGACCCATATCGACCGAACAAGACCTCAGAGAGGATCCGCTGTAACGGATATGGAACACCCACCACATGCAAGATCGAAGGAAAGACCGA
AGTGAAAAAATCTTCGAGGAAGACAGGCAGATCTTTTAGAACTGCCTAAAGGCGTCTATAGAAAACAAACTTTAACATCAAATAGACGGCCGACTAACAC
CACCACCACGAGTGTGGCTGCTGCTGCAGTTCCATGTACACTACAATCGCTGGCTCAAACCAGGCAAGTATTGTCTCCATCCTGTGCGGTGGCATCAATT
TTTCCTAGCGTCTCGTGTGAGGTGGTCGCTCATGCTGGCGACAGTTCACACGAAAGGTGTTGTCATCTGGGTCACAACACTACTATAGTAATGCGAGAGC
TTGGTGACGTCGATGCAAGTGATGTTTTCTATGACATTGGTGCGGATCTTTGAAATGTCGTCGCTTAAGTCGTGCTCACAACCAAGATATCGAAGGCGAT
TGGCATCGAGGTGCACGCAGATGTCTACAGACTTGACATGGAGATGATTACAAGGAGCTCCCATGGTCGCCATGTTCATGAAAGAGCTGAGTTCTACTGC
AAGGATATCACCGGCATTTGCTTCTTGCGGACCCCTCCGTATCAACAAGCTACAATCGTGTTTTAGAACTTTTTTGTTTTGTTCAAGCCTGTCACGATGG
GATACATGAAACGCAAGCTTAGTGAGATGATTCATGTGCGCCTCTTCGTGTGCACAGCTCGCATTTTCTCACGACACCGCGAGCCTTGCTTCGCTCAATT
CTGTCCTTCCTTGAGCTATTCGCCGAGTCACATATCGCCTGCAGCTGGAACGTTGAGCCGCAGCGCGCGTACTTCTATCGCTCGTACCAGTTTTATTGTA
ATTTCGATAGTAAAATCAATATAAATACACACTTCACCACGATATGTGAACCTTTGTCTCCAACCAAAAATGATGTAAACTATTACCATACTTACTTCAA
GATATATGCGCACTTGGACCAAGGTTTTGGTAGCTATAGGTCGATTGAGCGTACATCACTTCGGTGACCTCCAGCTGGTACTTCTTGTCCTGGGGTTAAG
TTGCGCTGCTCCATGCTCTCACGTTTCATCTTGTACAATTACAAACTTGTGCGTACATTGCTCTTGGCTGAGAACAGCTAGCGTGGAAGATAAAAGTAAT
GGTACTTCTCCCAGCACGTCCATGTTTGTTTGGGACACATGAACGGCTCGTTAGCCACGAACACGTGCTGACAGAGGCAAATCCTGTGGATAACGCAGAA
GTCGGTAACCTCTGTTGCGTATCTGTCCTCCCATCTGCACACTACACATTGCCGTCGCTTCCAATTCGAATCTAGGTATAGCTACTTTGAGGCAATCGCA
GAGCACCGCTCCTGGGGGCTACCAAGGACTCCACCGACGTCACGCCTACCAGCAACCCACATCACACTGGACGGCGACATCTGCTCGTCCACCGCTGTCG
ATGTGTCCATTGTGTAAAACATGCGTCGTTCGCTAGGCTCCTCTTTTCATTTCCCAGACAGCAATTCAGAGCTGAGCTGGACAATACAGTCGCGGTGGGA
GTCGCGATCATTAGTGAGCCCGAGCAATAATTTGTGCGTGAAATACGCATTTGAGCGCGCGACATCCACAAGCGCGAGACCCAGGTTTTTATACCACTTG
TTGAAAGGATGGCCATCCACCAAAGAGAATCTCCCTCGAACTTGGTCGAGTCGATCAACACTGCATGTTTTGTTGTGCTTCTTAATGCATGTTGGGGCGC
TGAACGTTCACTTCTCGGAGCGGACTTGGCGAGTCAAGGTAGTCAGCGTCGATGCATCGGCATTAGAAGTCACGGTGATAATGAAACTATCATATCATGA
GGCCACCACCGTATTGCAATCAGCAGAAGCCCCTTGTCCGGAGGTTCCACGAGTGCAATCTATCTTCTCCACCACGGCGTACCTCGGAAAATGTGCACTA
GACTTTCTCACGGCCCCCCGTCCATACACGCATAGCATCTAGTAGCTGCACAGATGTGTTGTAGTAGTTGGAATTGGCAATGCGGCCGGTTCCATACAAC
GGTCGAACTATTTGCAGCACACACTGGCGGATTGATGAAGATACTGCTATTTTATCACTCAGGGCTTGAGCTTCTGCTTGTGCCGTCACACCTGCTAGCC
CTTCCGTCACATCGCACTGACAGTGTAGCCGAAAGTTTAGCGGAATCCACGTGGTAGAACAGCAGAACATGTAGATGCGAAAATGACACTTCTGTAGGCT
TCATAGGATTGTACACAATCTGTGGCTTGCCGTATTTCAACCTGCACGCGATGTTGGCTTCGTCTAGAGCTACATTTCGTCCGACAGCCACGTACTTAGA
ACCTGTTGCCTTGAGGATATTGAGCAGAAGTCTGATTCTAGCTGACTGGTCACGATTGCCGTTGTTCACTTCAATGCACTAAACCCAAAACGCTTGTCAA
AGCTGCTTGAACGGACGAAGAGGCATCGCTGTATCAAGACTAACTGGATTTCCTCCAAAAGTTATATTCCACCTGCTGTCCCCAGTGGTCGCTGTACTCG
CCTGTATTCACTAGCTTCATGTAGAATAACACACCGAGAAATGTCATGGTCTTATCCAATGTAAATGGTTACGCAAGTGCAATGCCGTATACACATGCAT
AGCTTCTTCTTTTTTCTTTCATCACTTGCTGCCAGAACGAGACAGGAATGTTCGCGAAGAAACTCGCTGAAGTCGAGTGCTCGAATAGGTACTTGAACTG
AGGTAACAGACCCATTGTGGTAGTGCCGTCCGCATGCTGAAACAAGTCTACTGGCTCCTCGCTCTGCGCACCAGGCTCAAACCGCGTGTTTTTGATGGCC
TCAACCTCTGCTAGCGTTGTTGGTAGCTCCATGGGTGGGTCGAGCATTTTCATACACTCCTCCGTCTCGTCAATATCGCCCTCCACTTAAATACGTCCCC
CTTCCTCAACGGCATAAAGATGTCTCCAATCCACCCTCGAAGAACTACCATACTGAGCTGAATCCTGAGCTCGTCGTTCATCCTGGATCTGGCGCACTCC
CAGATCCTGCTTGCAGCTTTCTGCATCGGGACGAGCGGTCTCAGCACGTACAAGTCGGTCCGTGAGTTCTTGGACATGGTGGCGTGCATCCACATTGCGT
TGGTCTCTGCGTCACTCTCGCTTCATGGCTTCCAAGTGTTCTCTGGCGAGACATTTTCTCTTCTCGTTCTCCATTTGGGCCTGCCACTCTTGCTGATGTC
GCATGACGTTCAACTCAATTTGGGCTGGCCCAGAGCTGGCGGACGACGCTGATCCAGGATGCCGAGATGATTTCCTGGAGGAACGACTGGTATCTCGGAT
TTCGACGAGTGTCAACCCTAGAGCTCCGATGTCTGCTTCGCTAATCACTGTCAGAGTCTTCTGTATCAGGATTCACTGCAGCGCCCCTGGAAGTCGCTGA
TGGTATCCTGGATAGCTTGCTCCGGCTCAGCCACCACGATGTCATCCTGGTTAACAAGTGCAGAGCGTGGTGGAAGCACTGTTCTGGTTACGTTGAAACC
CATCGAAGCATCAGCAGCGGCAACACCGCCTCCACCTTGGGCTACAAGTGCTAAAGCAGCACCTACAGTGTACGGTATGTGTGACGAAGTACTCCGATCG
GTCGACATCATCGATGAAGACGACGAATTTCCTCGTGAAGTATGCGCCCCTAACGTTACGCTTTCATCCGAAGACCTTGAAGTGCTAATGACGTGGCAGA
AACTGTGTTCATGGCCTCGGCGCCCTGGGTTACAACATCCTGGACACTTGAATCCTGACGCGATTGATTCGTCAAAGACTGGTACGCTGGCAGTGAAGAG
AGTGACGGGGTGGATATTGCGAACGGAGTCGAAGGCACCAGTGGACGCGGTGGTTGATGCTGACAGCGCTTCTACCTAGGTTCGCCGTCGCTTGCCCCCC
CCCCAGGATTTCTGGTTACCCTGAGTCCGGTTGCTCTAAATCTCAAGACAAACTCTCGTCCAAGCACATCCGTGTCGTAGTCGGTCATCAATAGATTGCC
TTTGTGCATCTTGAGTGTGATACTCCAGTCTTGGCGATTGCTTTTGAATCCTGGGTGCAGGTTTCTCCTCGAGAAAGGGAATCACCTCTAAGCGCACTCC
AGCGATGACTTACCTCCAGTCCATGAGTTCAGCAGCAATGCACGCCTTGATTTCACTCGTCACACTGCATACCATGTCATCCGGAATCCTGGACACATGC
GTCTTGGACCATACAAGAATCAAGTTGGAGAGCTCAAAACCGGCTTCAAATAGTAGTGTCTGCAGAACGACGGCACATTCACGTGGTGTCAGCATCGTTG
GCGGAATTTGGATCGCAGTGAGGTCTTGGGCAGTGCCAGCACCCCAGTGGACAGGATTCACTTCTGAGATTCAGGCATCATCCTGACATTCCGAGAAGAG
CGCCACTTGAAGTAGTCTCCCGTCGCGAACGCTGGAGACACCATAGCATTTCCACCTCGCGCTGCCTCGCTCTCGCAAGCAGTCTTCCGCGCAGCCCGAG
CTTCTCTGGAGATGGCGTCCAGATCCTTGTGCTGGCAACCCTTACACACGACGCAACTGATGTGACGCCTCACTACGTCCGCCACCTCCGCGTCCAGCCT
TCTTCGCCCCTCGTCCTCCCGGCTTGGTGAATGAATCCAGAAGTTGACGGGCATTCAGCAGCTCTTCAACATTTGGGATCGATGAAATCCTCGATAATCA
AATCCGGGTACACACACCAGCTGTGGTGAGGTCAATGAAACATTTACCGCCCAGGGAGGTTCGTATTGCGCGGTCCAGGAATTCCTCCTCCAGGATTGAA
GGGGGAAGACTGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTAACGACTCGTTTGTCTTTGACGTAACGGCACTTCACCGAGCTTGTGGTCTTGAAG
TTGTGCCGAGCGTACGTCCACGTCTGGATGCACCCTCAACGATAGAAAGGAAGAGTGTAGTCTGGATTTCACATCCAGAGTATCAGTAATCCAGGGTGCA
CCTTTACCCATGGTGCACCCCAAATACGAATAACTAACAAATACAGAGTTATATATAATACAGATAGCCGTCACTTATTCTTATCGACCCTTGGACGGTG
GGTCACTCGCTAGGCCCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAGCACTCGTATAAAACGCGCACCACTCTCAATTAAGAGAGAAACTAT
CAATTACCGGAGTCAGTCGATACACACAGTAGTTAAACTATCAATTCGGGGGACAACTGCTAATCAGTCACCCAGAATACCAGGGGAATATGAAATGGGC
AAACACCATCACGCTAGCGACCCAATTAAAATATGAAATAGGTGGGTCAACCCAGGATGCTGGAGCGTCTCTGGTCACCATCTAACTGGACTTGATGTTA
TGAGGTGGAGATGTCACAGACAACCCGTCCTTAATGGTCGCAGCGCCCTTTGTTGTATCGCAAAACTCTTATCGAAAGGCACCCCTTGCAGGCGACGGTT
AAAAAATATCAACCTATCAAATTACTCCATTTTGATCATTTATCATGACATATCGAAAGACACCCCGGAGATAAATTACCACCAGTCGATAGGTTACGCA
GCGAGCTAGCCATTCATCAGCACTGCACTTCGCCATAACTCAGCCTGCAAGAATGCCCCGAGGAAGCCGCCCACGCGTGAAAGGCTTCGAGGCTTCGCCA
AGCCAGTGCCTTCGCACTGCTATCAGCTACCAGCGCAAGTATATTATTAATAGCTTCGTCGAGCAGAACGGCATGTCAGCAGCAGTAACACGCTTCTATC
CCTCTCTCCAAGCGGAAGCCCGAAAGCGGAAGAAGCGGCAACTGCACAAGTGGTTTGAAGCCCGTGATGACATCGCCAAACAAGTTGCCCAAGGCAACGG
GCTCCCAGTCTGTCGCATCAACGACAGCAGCTTTCACCAACTGAACCAGCGAGGTGACCGTAATCTATTCAGGAAAATATCTTTGATAAATAAATTCCGA
GTGATGCAGCTGTTATTTATTTGCAGATGCCTCTTCCCATGCATTCGGCATCCCTGGTGCTGCAAGGGGTGCCTTTCGATAAGAGTTTTGCGGTATCGCA
GTCGAAGTCTTGGGTCCCCAGATTTCTGTCGGCAGGCTTGGCCAATTTCACTTGCGCAGTACGGGGTAAAGCAAATTCTGTTGTTGACTGTAGGCCTTAA
ACTATCAATTCTTTCTAGATCTCGGATCTGGGTGATTTATCTTGATTTCACTATGACTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTG
TCTTCGTAGCTTCAAAAGTGTCGACTCGACAGTTCTGCTGGATTATTTGGTGGTAGTTCAATTGCATTTCACTTGATGACGTACTACTGTCTTCGAAGTC
AGTAGTCAGTGGTCAACCGTCAAGGTTCTGGTATTCTGGAGTCAGGATTTTGGATACAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGG
GCTTCCAGCGCACGACTTGGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGATACAGTCTGAGATA
CGTTCTCAACTGCACTTTCCGCCAGAATGTAGGCACTCGCCGTAAGGGAAGTCCAGGGTTGGGCATAGTGCGGGTTTGCAATCGTGGATTTGTGCACACC
CAGGATACGCACTTCCAGCCAGTTGGGCCCATCTGTGGTTAGGCGTAAGATCTTTCCATAAATCAGTCGCACTCCATACATCACCCGTGTCCCACGGGTA
CAGCCGAGCCGAGTCACATTCTCCATTTCATCCAATAGTATCCATGCTCAAATTTTAGACCAGAGTCATGACGGCGGCGCGTTACAGAAAATCCAGGAGC
ACGTCGTGTGAAACGCATTCACGCGGTCGACTTGCTTGGCTGGCGTCGCCAACGACTAGACTCGGCGGACATCCCTTCCAAGGATGTCTCCCATCTTTCG
AATGGACTCGAACTACGAGTCGTTCAATTGACGATACTCACTTAGAAGAAACACACTTCGTTCCATAGTGGCTCGGCTGAGACCACAGAGAATTCACGTA
GTTCCATCTACCCGCATATTGACTACAAGTGCTACCAAGTGTGACGGGGTACTGACTCGAGTACGTGCACACGTACATGTACACACTTGCTATCGCGTGG
AGATGTCTGCGGGTATGATGGTGGCAGATCATCGCAGATCAGTCACACAGCATCTTGCACAGCGGAAGTGCTAGAGAGCGGAAGTTCTCGGTGAGCAACT
AGTTCACGGTTCCAGGCCTAAAGGAACCGACTACGACTTAGACAGTAGGTTACAGACTGCATATATTTATAGGTGAGCCAAGCTTGATCCATACAAACTC
TAAGTCAAATATAGTAAAAGCTATATAAAGGTCCGATGGTTGGTTCACCGCCAACCGGTACCCCGTTACACTTATCTCCTCCCTTCGAATAAACAAATGG
TAGCTTTTTGACACGAACTGGTTTCAGGCGGTTTCGCAGCTTGTTATCGTTAAAGGAGTGAGCACTCCATCAAGGATTTCGAAAAATAAATATCCAATAG
AGTATATATACTGTTCTTTGCATGCTTGTTGTCCATCAAGTTGAAACGCACCCAATGCTGTCAGTTTTGCACTCCTAGCCCTCCATCTCTGGTTTACCAG
GCTGTAAACAAGACTTCAAAACAGAGTAAAAATGTAAAGAAGAGTTTGTCTCAATAAAATCGAGTTATCAGAACAATATAACTTACTTTATCGAGCGTTT
TGACAAAATGTAGGCATAATATCACTCCGCTCCGGATCTTTCATAAATCTCTCTTGGGACTTGCCAATAATAGGCCTACGGTAGCGTGATTGGTCGAACA
ATAATATGAAGGATCAGCCGGGTTGAACGCCGTGCACATTTTCCAGTGCTCACCACGATAATATATGTAAAACTGAAACCAAGAAAATAAGCTCAACTGA
CCTCATATTTTTGTGTGGAAGTGAATTCTTTATGACAAAGTGGATCTTTTTCACTCTCATGATTTGAAGCGACATTTTACAGTTGAAAATATAAATTCAA
AATATGGACATGAATAAAAACTGAAGGGGATAAGCGTTGAGTGGTAGCATTTGTACAAAAGCTCAAGAAACGAATCAGCATACATGCATCGATAATCCGA
CTCACTGTCGGTTGAAATCCAATCGGAGTCGATCGCACCCGATCGATGCGATTGGGTCTACTTGATAGTCTCCTGTTGCCTGTCGCTGGCAGCCAGTGTA
CTGTACCCTACAATCACAGTGGAAACAGGTCAAGTCATCTGAGCAAAGATGCAAAATTCACGCGTGAGACAGTGCATCAAGCTGTTTATCGTTTGTGTCC
TCAACCGTGCTACATACGAAGTAAGCTTACATGGATACCGATACCCTACGTACACGTAGGAATACGCGTGGGGAAATGAACACTGGAAGACTTCACAGTG
TCCGTCCGCTGTCGCGACACAGGAGACACATTACCCTAAAGTTCGAATTCAGTGAGATAGTGGTAAAAAAAGTCATTTGCTGTATAAAAATATTCAAAAT
ATTGTGCTTTGCAGATTTTTGTTGCTCCATGTAATGAATGACCTCGACCAGCAAACAAATCGAGGCCATAAACATGCGAAAGGAGTTAAAACGTGCCTTA
TACATGTATTGGCTTCTCCTTACCTGCTAAAACGATCACTTCTGTGGCGGTGAGCCCCTTGAAGGACGCCAAGATGTAGCCGGCTGCTAACGCTCTAATA
TTGCTCTGTTTGCGCTGTGCAATGGCTCTTTAGTTTCGTCTGTGTGTGTACTAGCTGTGCCTGCATCGTGGCGCGCTGCTTCACACCTGTGAGAAAAGTT
GCTCCGCCTCGAGTAAGTTCGCCCAGCCAGTGTTGTGTTACTTTACTAAAATCAAGATGTCGCCTGTTGATCCTCTATGTAAATTGTAGGATGGCCTTTT
ACGTACTTGAGAACACGAGCTACTACATTGCACGGCCATCATGACGAGCGGTTCGTTCCCTGTCTGTCTTCCACTACACCATTAGTTAAAAACAAGTTGT
ACCAACGCCGCAGGGTCCGCATATTCGGGCCAAATATATCACTAACACACTGCGTACAAATACCATAGAATGAGAAAGATGGCTCGCGTCTTGAGAATAC
ATGCTGCACTTGTGCGCGAACAAGGTTATTGAAAACTGAGCTAGTTTGAACATGAGCTGCATCCCCCAATTCCTGTGTCCGAAAACTGGCGCCGCAATGC
TTTATAATGAGTATGAAAATGGTGCATTAGTAGCCGGACAGACGGAAAGATGGATGTAGTATAAATCGGCCCGGATTGCCGGTTTCAAACGGCAATTCGA
GGGCCTTCGATATCTAACTCCAACCTTGCGAACTATAATCAAGTCGAATTGTCCTATCTTTTCCACCATCTACATCTATATCGAGCTCCAGATGTTACAC
TTCGACCAAAACGAGAAGTGAAAAGGACAAACGCATTGCAAAGCACAATACAGGTACTGGTACGAGGATAAATTTACTTTTTACGGTCGTAAAAAGTAAT
TTAGTACAATTTCCAAGTCGCTCCTAAAATATCGATTTTAGTTTTTACTACTGTCGCATTGAATCCATGTGTCTCTTCTCACTGAATTACGGCAAGATTT
GCCAACGCGCTGTTTTTTGTTATGATCGATGTTTTAACCCATTGTTCCGTGAAGGGCGTCCTATAAATAGTAACTTGCAGAGTCCGAAAGGGCTACAGAC
AACGACGGATAAATCCGACACCACTGACTGACCTCCCCCATACTAAAACTCATTGTAAAAGGACTGCTTCTCTGTCTAACGTTTACATGGATTCTGCATA
AACCACACGCCAGCATCGCATAAAATACCCGTAAAGTCATAGAAAATACGCAAAAGCATATGGTTTCGAAGAACCAAGTATAATAATAGAATCTGATTAG
CTAGATCGATTCCCACTGTAGGTACAACTCGTTTTGTCGGAGGTTAGTGTCGGTCGGATGTATCCGTCGTTGTCTGTACCGGTAGCCGGCTACCGCCACG
CAACCCTCCCACCTCGAGGTAGGCACATGGCGACGCTATTAATAAATCGAAATTCGCACAAGAGACTCGAGCGAGAAAGTTAACCGGAAAATTCATCTGA
AGTTATCTAAAAAATCTAAAAAAAATCACTCGGTAGGCTCTGCATGTAGAACCAGACGTGTGGGCGTATCCTTAGACAGACAGATATATGTAACAGGAAG
GTTGCCGCCAAACGGACAGCCAACAAAGAAGGAAGGACTTCTCGTGCTGCTATGTATCTGCACATTGATTTATAATGATAAGTCTACTTCCTCAGGAATC
CTACGTGTAACGGATACCCAACAGGTATTTTAGTGTTCGCACATACTAGTACACTGTACTGCTTACACTACTGTTTGCAGACTGTTTGTTCGTGTATAGC
TCATCTGGCCAACATGTATGTGGAGTTAGGCGATTCTCATTGGTGCATTATAGAGTTTGTCCTCGGCTCGCAATGGCAGGCTGACAAGGACTCGTGCACC
GCCATCAGTCATCTCACTTCAGCTCTGTTCATTTTCCAATGGTCAAGCTGCCTATCAATTCTCCCCATCGCACCACCAGTAGTAATAACTACATCGTAGC
TGTGTTTAGTATGTACGAAACACACACAGACTAACACGTTTGCAAACACCACTTACTGTTAGCTGGCGTGTAGTAAGATTCACAAACACGTCTGCGGAGT
ACATTACCAACAAGACGGGTCGGCAACAAGCGCGACTGTTTCCTCGCATGAGCACACTCGCAATCAGCGTTCGCACAAAACACAACAAACAGAGCTGCTA
ACACTGTTTGCATACTGTTCGTTAGCGTACAGCAAAATCTAGCTTCTCGTTGGTAAACTTAGACAGTTCTACTTTGGCTCATCTCAAATTGATGTTCCCC
AAGCACCCCACGCATGGTAGCGGTTTGCTTAGTATAAATCGCAGATAGACTGACCAATTGTAAACCCACTGCAAGTACATTCATGGGCACACTTCATCGA
GAGTACAATCCTAATACCTGTATGCAGTAGTAGACTTCATTATGCACTTTAAGTGGGCATGCTACACTTCCCGTGTAGGTAAGCGTTTTGACTTACACTT
ACAACCGGTGATTCAAATCCACTGGAAATGTATAGGAACGGCAGATCCCCCTCCCAGCTATTTTATTAATACACTGTCACTGAGGTGCCATTCCGTTCTG
CTCCTCAAGTTACTTTACACGAATAAAATGCCGAAGTGGAAAAAATGTGTCGGTTGTTCTACCCAGATGAAATCTTATACAAGTAGCAACGCCAAATCCG
CCACCCAGAATGGACACGACAGAGGGAAGACGATGCCCAATGCTATGGTAGCCAATCCGTGAAAATAAGCATGGATATCCGGAACGTTAGTACATGTACC
GGCGTAGTGTACTGTTCACCTCTACCAAAGTACTACGAAGTAACATATTATCCCCAATCCCCAAGGATGCCCGGTAACTCTCGAGTTTATAAGAATGCTG
AACAACTTCTTATTATAGCACAGTCTTTGGTTGAAGGGTGTGCTGTCTGACTGAAGGACGAAGGGGGACTGTTAGTGCCAGATAAGGCAAGGTTCCCACC
AGCACGACTGAGTGGCTCGAGCAGAATGGTTCAAGAGCCCTTTGGGGACCATTTTTTTTCGGGACAGCAGTATACTTGGGCCAAGTAACACGCCGGAGCC
AGCACAGTCGGCATCTTGTAAGTGATCTGTTTGTCTTCAGATGGGCTTAGAAGTCCAGCTGTTACTTTAGTACTGAACGCTCGTTGATCACGTAGAGACT
ACCGGTACACGAAAGCGCCAATTGCTTGCTGGCAGATGCTCCACTAGTTTGTGTCTATCCTTTTGGCAGGCTCTTCACGCATCGAGCAGCATTTCTGAAC
TCGCAATCCCGACAACAGGCGTCATCAACGTTCGAGTTCGCAGCAGTAGGAATGAACTCGTCGATTCTGCGGCTGTCGAACCAAGGAGTACTACCTAGGA
CCGCCCTTGGCGGTGTGGAGGAGCGCAACATGACGAACAACAACTTCCTCACTAATGGCAAAGGTTCGAGGCAATCGCATTTACGCCCTCGAAATTTAAC
GTGTTATTCACCGGCGCCTCCAGTAACGAGAACGCGGTCACCTGGTATTATCTCGGCTGCTTCTGAAAGGGACGCGGTAGCGATAGACGGACTGCTATCG
CTCATGGGCAGGAAGAGAAAGAGGGAACCGTCCATTTGTTTGTACCCCTCCAAGGCTCCGTCGCCGAGGTCTCCTGGCGCCAGTTCGGCGCCAATGACAG
ATACAGAGTCGGTGAAGAGTGATAAGCAAGACGCGGTCATGCTGGATTTGGCTGCCTCGCAGAAAAAATTCCAGCACGAACTTTGCCGGGAGAGGCAGAT
CAGGTACAGGAAGGAGCAGGACGCCCGCACGGAATGTCTCGGGGAGGAGATTCGGCAGCTAAATGAGGGGATCGAGACGCTCGAGCAACTGCGACAAACT
ATTTCCATCGCTCTCCCGGCAACAGAAAATGTGTGGACTGTGGTGTCAGACTACTTCCGTCTCTTTCGGCACGGCCTCCAATCGATAGCACAAGCATCCA
ACCCAACCAACTCGACTCGGACCTCTGCTCAAGTGAACTTCCTGCGGACGATGATGGCCCCTGACGCTGCGTTTAACGCTGGAAGAGGCTCGGAGGCGAT
GATCCGGAGTTGGAAATGCATCTCACTATGGTTTCAAGACGTCGAGCTTGAACTTGAAGAGTTGGTTGGGCGTGCAGGCGACGCTCTTGTTGCTACCACG
ACAACCAGCATCACTGTCACGGAGCGAACGCTTAGAAATGTGTTTCCACACCTGTGCTACAAGAGTCAAGGATACGATACGCTAGCAGAGAAACTGCTCG
GTCAACGTATCGTCATGTGCGGCTCGACACGTTTTGAGTGGGACCCTGAGCTTGGCCGCATTATCAGCGTAATGGCCGAGTCAGATTTGCTCACCCCGAT
GCTGCACCTACTTGGCAATTTAGAAGATGTCGCGCGAGTGTTCGAGAAGTCCATCATTTCTCCCGATTTCATGTGGAGGTCGACGTCGTAACTCTAATAT
CAAGCAAAATACAGGTCGTCATTCCAGTATAAAAAAAAACAAATTCGCCTCGCCTTGTGGGCAACCATCAGTGGAAGCTGGGCGAATTAAGCCTCGCAGC
CATCTTGTCGAGGCGTTTCACAAGGTTCGTCGTCACTTTCCGCGTATCCGCCGTACTGTCATAGAAGATGTGGACCTTGTTCGCCTGCACCTTCGGGTGG
CATGACACATACTCCTGCATCTTGCGCGCAAGGTCACTCACGTCACAGATCGATTGAAGCAGGGGCGCGACTACGTGAGAAGTCACTGCGAAGAAAACCC
GTGCCTCGAATTCGCCAATTTCTTGATACTCTTCAGTGAGAGGTTGAGTAGCCGCAGGAAAGTTGAACCCCTCGGCCGTAAAGTGGCTGCCAAAATTAAA
ACCTCCACGAGTTTGGTTAGCGTCTCCGAAGCCTGAAGAGCGTGGCTTGTTCGTTGGAACCTGTGCACTAACAATCAAGCGAGACATTTCTCTGACGAAA
AACAAACGCAAAGATGTGAATTTCCTCAACACGGCGCCACGTATGCTATTGGTAAATCGAAGCGTACCTGTCCAGGGATATATTTGCGGGAGGAACAGAT
GGGACGTAGATTTCATCGAGCGAGGTGCTGTGGAATCCTTTCGAGTCCAAGTACAACTCCAAAGCATTGGCTAAGGTCTTTAGCTCGTCTGCTGCTTTGG
TCGGCATCTTCTTGACCTGTGTTGGTAGTTGTAGAAGACTTGCGTTCTCTGGGTCAAACTCCAAAAATGATTTTTCCAAGTGCTCCAGTAGGTCTTCGTC
ATTAATAAGCAGTTCGTTTAGCCGCTCCCACAACACGCCAGCAAAAAAGTAGTGAAGGTTGGCGAAACGATCCAGTCGCTGCAACTTTCCACCCTTCTGC
TCCAATCCAATCGTTTTCTGAACGAGATGAACAATGTGAAGCACTACATTCTTCAGAATCTGGACCAAGTGATCGGTGATGTACGTGCCATGGGAGTCTA
GCATCAATATTGATGCTGCCACAAGGGATCCAGAGTGTGTTCGAGCCGAGAACGGCTTCTTCGCATGAAAAGGAGCTAAAATCAGTTCGTGCTCTTCCCT
AGACTGCAAGCAATCCTCGTGAATAATTGCTGCGAGCTGTAGAATATCTTCGTCAACACGTTCCAAAAGTCCAGGTAAAATGGGGGTTATCAGCTGAAGC
ATCCTCTTCCGAGCTGTTGTTGGAGACACGCCAACAAAATCGCTCACGATATCTTCTGCAGAAGGTCCTAAGCTCGCCAACGTGTTGTAGCAGTTTCTAC
GTTGAGTTTCAATCTTGGCCAGAGCCTGAGGCACCCAAGTGGCGCGCGCATGGTCCGCCAGTATCTCCTCGAGTTTCTTTGCCAGCACGGAGCTGGATGC
TAAACCACGATCGATGTACCCCGGCATTTTCTCTTCAAGCCACGCATTTTCTTCAGCCTTGGCTTCATCCAACGACAACGCTGGTGCTAAACGTGTATCG
CGGTTCTTGACCGCCACGTATCCGTGTTTCAGGTCCACAACGTCTTGCGATGTACCCTCCAGTCGACTCATGACTTCACTTAAAGGGGCATCAGGATTCG
TTGCATCTACTGCACGATCCATCATCGTGAGCACGCCGATCGTGCTGTCCATGAGGTTGTACTGCTGCACCAACTGGAACGCCTGCGAGTTGCGCACTCT
CTCAAAGGCCGGTACAACCGCCAGTACCAGTGTGTTCGGCATCTTGAGATATTTCTCCACGAGCGCTCGAGTACGCTGCATCATGTCAACCGGCTCGCCG
ACGCGTCGTCCCGCGACGATACCCGGCAAGTCGACCACGTTCAGATTGGGCACATGGGGTGATTGCACTTCAATCTCCAGCACGTGGTCCACGACTCCTT
CCTCGCCCTCCTGGGCAACAATTTCCTCCATCCACTTGCGCATAAGCTGCGCTGCCTCGTCGGGCGTAAAGTTCCTATCTGACTCGACGGGTTTCCGCCC
GTCCGAGTACGCTAACTTCATTTTAATCTGCTGCTTGGCTTGGGGCTTTCCGCAATGCGGCATGAGGTCCGGGTCGCCTTCAACGTCAACATTGCCGTGG
CGCAGTTTGAGGAGGATGGGCAGCTTGGTGCACATGACGCTGTCGCGGGGGAATAGCGGCAACATGGCGAGTGCCTCCAAGACGCTGGACTTGCCGCTGC
TCTCCTGGCCCACGACCACGATCTGCGGTAGCGCGAACTCCAGATCCGCCAGAATGTTGGTCCCTTCTTCCGTCGCCCGGTAGAAGTCCCCCACGAAGCC
GCTGAGAACCGCAGCGGCGAGGCCTGCAGCAGAGGGAACACATGGTTCATGGGCTGCGGAGTGCTGTACTGGGGGTGCTTCTTGGCGTGCTGGGGCGAAG
GAGGCGCCGCCGCCTGCAGCCACGTCGGTCAGGCGCATGGCTCGAGAATGCGGAAATGGGTTGAAGCGAAAAGTCAATAAAAAAAAACAGAAAAAATGAC
GGCGTTCCGTCCAACAGATTGTGGATTATTTGTATTCCGCAATAGCCCCCGATGTGGTCTGCAGTTCCGATCGAGGGGTAAATGCGATAAGCATCTTTCA
CAGACGTGGTAGTCGAGCTCGAAGGATAGACCGGGGGGCAGGGTGTATTGGTTGCGAGACCCACACCCAGTATCACCATTACCAACCGAGTGTTTCGTCA
CATATTTCCAGTGAGTTGATCCTTGCTTATCTGTTTTCTGCAGCTCGGACGAACATGGTGGAGGGGGGAGAGGAGTAGCGTTGATTGCCAGCATACTTTT
AGGACGGCGGTTTGTCCTGTACGGTCCAACAAGAAGAAATACGGAGGCGAAAACATGCTGGCTGCGAGCGAGCGAGCACTGGACGTTGTGTTTCCACATC
TCACAAACGGTCGATTGTGATCTCAGTGATGCCTTCTTGGGCAGCGGATTGTGATTGCTCAAAGTGGCATGCTGACGCCGATGCTGCGGCTACTATGACA
GTAAGCGTGGAGAACGTCTCTCGAGTATTTGAAAATGTGCTATATAGTATCCCTTGATTTCCAGTGGAGAGCAAACACTCGACAGCAAAGCTAGCATTAG
TTCAACATGATGACTCTAAAAAAATCCTTCCCAATGCGGTGGCTTGTTCGCATTGAAACACAGTCTACGACGGCAGTTCGCAGCGGGGCCCTGTTAATGC
AGCGGATGAGCAAAAGTTATGCAGCAGGATTCAGTAGAGACTCTTGGGCAAGCAGTATTCCTTCAAGAGTCATCAGCACGAATCATGGCTCGGCGAGGTT
GGCTCTGGGGTATCTGTTGTCGGCATGCCAGTTGTCGGACTCTCTGTGGTCGGTAAGCCCATACTTGGCTGTTCGGTCCCGGGGATCACGGGGCTCGGTG
ACTCAGTACCAGATATTGAGGTAGACGAAGAACCAGTCGATGGGGCAGTCGAACTCGGAGACTCGGAGCCAGACGTAGGAGAGTCCGTCGCCGGCACAGT
CGTCGAAGGGGTGTCCGTTGACGCACTACATTGATCCGACACGTAGTCCACCAGGTCTCGGAACAGGTAGATCTTGTCTCCGATCGGCAGGATGCACTCC
GACAGCCCCATGGCCTCCACGTCGGCCAAAAGATTGGCACACGCGCTCGACGCACACATGCTCGAGGCCTCGGTGTCGTCGGGCTGCACGCCGGATGTGA
ACGAATACCCGGAGTCGGAGGCGCACTGGTCGATGTAGGCGTCAGTGAGCAGGGACGAGATCACTGTGGTCGCACAGGTCACGGGCATTGAGGCCGTCGG
CGCCGGGGTTGCTGGCGTGTCTGTCGGTTCCGGCGTTGCGGTGGCTGGTTCAAGCGTGTCAGTATCGCATTGGGCTGAGACGTAGTCAACCAGGTCGGCA
AGGAGCAGAATCTTGCCGCCGACTGGGATGCGGCAGTCTGTCATAACCATCGACGCGACATAACCAAACAGATTGACGCACGATTCGGACGCACACATGG
CCGCCACTTGGGCATCTGTGGGGGGGGTAAGGGGACGTGAATGCGTAGCCGGTGTCCGTAATGCACTGCTTCTCGTACGTGCTCGTGAGCAGGTATTTCA
GTTGGGCAGAAGTGCATGAAGCGATGGGGGCTGTGGTAGGTGCTGGCGTGGCGGTCGTCGGAGCGGGTGTCGGTGCCGCTGTTGTCGGCTCCGGCGTGGT
GGTCGTTGGGGCAGGTGTGTCCACTTCACACTGACCGGACACATAGTCGACCAAGTCGGCCAACAAGTAGATCTTGTCGCCAATGGGCAGCGTGCACTCG
GTCAAGTTCATGGCTTCCACGTCGGCCAGGAGGCTGTGGCATGCGTCCGAAGCACACATGCCGGCGACTTCTTCCGGGTCGGGCTGGACACCAGAGATGA
AGGAGTAGCCGGAATCCGCGGCACATTGGTCAATGTACTGGTCGGTGAGTAGCTTGGACAAAGTGGCGACTGCACACGACGCCGCTGAAACGGCCTGGAG
TAGCGATGCAGCCACTGCGGCCGCGACCAAGAACTTCATCTTCGGCTGTAACTGCGAACGGCCTGTAGTTGTTGCAACAACTGGGAAAATGGCAAGTGAC
GACCAGGAAGTGGTCCGCGAGCGGATTTGGTGCAGCGCTAGCGCGAGAAAATACCGGAAGAAATCAACTTGACGTGAGGGAGACCCGACGCGCTATGACG
AGGTGAAAGAGGGAGCTGAAACACTGCAAGCAACAGCAAGGCAACGCTGGCGGAGAGTACGCTTCCAAGCTCGGGCACAAAGTTGTCGATTGCAGTGTCA
GCCCAGAGAGATTTTATGCACCGCAAGCTGACAGCGAACCATCGCCGAGACAGACGTACTAGTCTTCAGGGCTTCGAGCTGGCAAAGGAGACCAGGAGTA
GCCTGCTTTCAGATTTTGTATTGGTTCGGCGCTGGTGTCGACAGCAAGTACTTGTGCCTTTTCGAGGCCACGTTATCTGTGGGCTCCATCTCACCGGCTG
GTTGAAGATCGCGTCAAAGAGTGTTCTCGAACAGAAGTCGGAGTGGCATCGTCGACCTCCCTAGAACGCCGGACCAGCTCGGGAAAACGCCGTTCGTGTT
GCAGTGTTGGCCTTTGCGGACTGGTTCCCAGGGCGAGTAACACCTTCAATAAAATGAGGAGCGCTGAGCAGCGTCGCCGAGGACATGATGGTCTAGTGTG
CTCCGTCAACGTGTACATGTACTGTACATGCAGCTGTGAGGCTGAAGATCACAGCGCAACACTACTAGTACGCTGCATTCCGCACATGTACACTCAACAC
CAACGCGGCGGCAACAAAGGCAATCGCGGTATCAATCTGGTGCGTGTACTTCGGTATGTACATGTACAGTAGCTGAGCGCCGTCCGGGAAAGCAACCCAA
GCCCAATTCGTGATGACTCCCACGTTGACGTCCAGCGGCGG