Description :
From Genome Similarity Track
Location :
Scaffold_18:577360- 587545
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09534hypothetical protein
Phypa_INRA-310PPTG_09535amino acid/auxin permease-like protein
Phypa_INRA-310PPTG_09536hypothetical protein

Sequence
10185 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AATATGTACTTAGAATTTGTGGCATTTTGCGTTTTGGTATGGACAAATTCTAGCACATCAGATTTGGAATGCGTTGTGATTTATGCAGAAATTTTGGGTC
ATCCACAAAATTTTTGCTGAAGATTTTGCTCAAAGGTGAGCTTATTTCTAGGATGTTCAAATAAAAAGGGTGTGCACAAAACCAAAAGCCTTCCAGATTG
GAATAGGACACCCACCAACTGCAAAACAGCACTTCTTGAAGGCGCTCAATTGGTAACCACCAATTGCTCTTTAGTTGGTATCTAGCTCGTTTCTACATGT
TAGATTCAACAAGTACTTACAAAGTTTGCTTACTAGAAATACTGTAATATCGGCAATGCTGTTTCTTCACATACATTTTCGGTATAATGCACTCGGCACG
CAGTAGTTCAGTAATTTACCTAAATATTTTGGTGGGTGTAACGTACTAGTAATTAGTATCACGATTGTTGGTGCCTGCTTCACGAAGCTATGAAGTGCAC
TTTACTCATTAACGTTAATCGTCGCTTAACTCGTCGACAAAATTTTCGTTCCCAGGCTCGAGGTTTGATCCTAGCGCCGTTGCGCTAGACGGATAAACGA
ATATCGGCCGCTTCGATGGCGGGAACAGCGCGAGCAATGCGTCGACAGTGCTGGAAAAAGGAAAGCAGAATCTTTAGCAACGTAGCAGCAACAGAAAAAT
CACACGCAAGAAAAAACGTACCCAGCAGATGACTCCAGGTATTCTGGACGCTGGTGCATAAGTACACGCATGAGGTAGAGAACTTTTTCGAGCACTTGGT
ACGACTGGAGAATTGCCCAGCTTTCTCCCCCGACGTCGAGCTCTTTCAGCACCTGGAGGTTCTCATTGAAACGGATGAGTTCGTTGATTGGCAACAGCTT
GGGATTCTGCGTCGTGAGAACCGTGGCCAGAAAGGTGTACGACGTCATTGTAAGAAATCCAAAGGACTTCGTTGCTTTCGCCTTCGAAAGTCGGTGGAAA
CCTTCTTCGACGTCTTCCATTGTGCGGAATCCTTTGTTTGGAGTCACATATATTCCTGTCATATGCGGGGGAGGCATTGATTTCAGGTCGAGCGACGGTG
AAAAGGAAGTTCCTGACATCTTGTACAACCACCCGTGCACATCGTGCAGACGGCCTTGCTGTACATGACTATCTCTGAAAGCACCCAGCCGGATAACCAT
GATACCAATAAGTTCTGCGAGCTGCGAATCCTCTCGTGGCTCCCATTCTTCGTATGATCCTTCAAGTATTTCCATCACGAATGTCATGATGTCCCCGAAT
CTCGAAGCAGTGTAGTCATTCACGCTCTCCCACTTCCGAGCCTCAGCTACAACTGATGACAGCTTTTCTTGGTCAATGACAGATGTTTGTGCTGGTCTTT
TATACTTCTGCGTGATAAACTTGCGTAGCTGAGTACTGCACCTGTACACGATGAAAATCAGAACAATGGCATAATGAATAACAAACAAATTCGGCTTCAT
TGCGTTCGAGGACACGTACCATTTAAAGCGCGCGGCCGACCCAGGAAAAGTATCTTGAAGATTCTTGAGCAGCTTTAGCAGATCACGCAGTCCGGAGCCC
TCCAGTTTTCCATCGGTCTCAAGAGCAGCACGCACGACGACGGCAAGAATCTGGCGTAAATCCTCTAGGCGGTCTAATATGTCGGTACAGCTAGAGTCCC
GATCCAGCAGCGCACTACTAGCAGCCCGGGCATTGTTTACAGCGATCTGAACGCTTTCTTCTTCGCCTTTTACTTTTGTCAGTCGAGCCACCTTCAGTGC
AGATTTAATACTGGCGGAAATGACATCGTGTTGCTCTGCACCCGAAAGCTTGGACAAACGCTTTTCCAGGCCATCGATCACTTGTGCCACTTTCTTTTCA
CTTTGCTGGACTGGGGAGCGGGGTCTACTGTGAAGAAGCCGATACTGGTGGTGTCGTGGCCAAACGCTTTGTCGTTCCAGCTCACGACGGATCATTAGAT
CTACTGTCGTAGTCGGTCTTAAGAAGGAGTGGGCAATAGGAGGTGCGAGACTAGTAGCCCGCCGCTTTTGACCAACGTATTCTGGGCCAGATGCCAATCC
GTCTGAAGAAATATCATAGCTTGCACTCGAACTTAGTGCACCAGAAACTGTTCGAGGTGTCGGGAGCTCACCCGTTCTCCCTTGGTCACGCACCCTAAAG
AACGACGGTGCTGGACCTCCTTTGTGCGGATTCATGATCCATCCTGATGATCCTAGACCCGAAGATCGGTACGGACCTGATGCTGGTGTCTCTCGATACT
GTTGCCTCACTCTCTCGTGGTTCGCAGGCAACGTAAGTTGTTCCTCGTCCTCGTCCTCCGTCGAATACCCCGAAGATCCACGCGATCGACTTGAAATAGT
AAACGCGTTCAACATGCACTGAATATCTCTCAGTACTGGACCAATCTGCTCGCTGGACTGTGCCATCCCTTTAACAGAGGCCTCCGCATCAGATGGCAGC
GTCACGACAGACCGCTGTGCATTGTGCACGTCTCGAGCGACGCGCACCACATCCTGTAGTCGCTTCAGGGACGCAATGGCGTCAGTCAGCTTGACCTCCG
TCTGCTTCACCTCGTCCATTACGGCGTCCAAGCAGAGCGAGCGCTGCTGAGTGGGGTTAAGCCCGGCGCGAGACAGAATCACGTCCATAATGTCGGATTC
TGAAATGTCATGCGCGGGAACAACCTCTAATTTCTATTCCAACACAAAATTTCCAATAGCGTTGTACTTCTCCCACTGGTGCGAGCAAAATAAATGACGA
TGCGACACAATTTGATTGGTAAAAAAAGAAGATAATTAATATTCTTGTCACAGTAATACAATGCCGCTAAAAACTATAGCCGCATTCATTTTTTTGACGC
AACGCAAGCAATACTTGATCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCCCACACCATCACGCTGCCGCCGCCGCTCACTCGCTTTGAGTACAACT
CAGTGTCAGCCCTGACGTCGTGCCAGTAGTACTGGTAGCCGTCATGGCCGTCTAAGTTGAACTTCTTTTCATCGCTAAAGATAACGCGCCTCCACATGCG
CGTCTTGCTCAAAAATTTCGCAGCAAATGCTTCACGTGCGACCTTATGGTGAGGCTTCATGGCTGGAGCAGGTTCACGCTTGATCCACTTAGCAGCGCAA
AATGAGCGAAGCAGATTTCGCGCCGTACTAGGCCTAAGGACATAGCCGAGAGCCTGTGCGATCCGCTTAGACGTGTACTTCTTGACTGTAGCAAGCCGAA
AGACACGCCTAGCAGTACGTTGGGTAACTTTTGTCGGCCTGCCGACCTTTTTTGAGGGGGATGACTTCTTCTTGGGGTTCAGTAGGTTGCGGATGGCCTT
GTCGCTGCGTACCGGATTCGACGTAAAAAATGCAACGACGTAAAATATGCAATAGTACGACCACATCCTTAACACGACAAAAAGTGTAAGGGTGACACCC
CCTCCATAATTGAAAAACTTGATGGTGTATTCAACTTTATTTTTTTAATAAAGTAAACAGTTATTGGTAAAATTGAAGATATTTTATTAATCTTCGTTGT
TGTCCTTCTCCTCGTTATTGTCATTCTCCTCCTCAGCCGCTTCATACGCTGCTGCGAACACGCCTGGCAAGGACGCCGTTAACGGTGACGACCGTCGCTC
GTCCAAAATGTCATACATCTCGAACGCCGACGCTGAGAATCCGTACCATGGTGACCTTGAGGCGGAAGCTGCCGAATACCACGGAGTGAACGCCATCAAG
TACGTGATCCTGCGTGTCGCCATCATCGTGGTGTTGGTCATCCTCTCGGTTATCCTGAAGGATCACTTTTCGGACCTGGTGGATTTCGTGGGCGCTTCGT
GCATCACGCTGATCAGTATTCTGCTGCCCATTATTTTCCTGCTTAAGAAGCTGTGGCACGAGATTCCCCTGTACGAGAAGATCCCGGCGCTCATCGTCGT
GGTCGTGTGCGGCTTCCTGGGCTGCTACGTGACGTACACATCCGGCAAAACGTTGTTCGCGCCGACGGACTCGGATACGGAGTTCCCGTACTGCGACAGT
GAATACGAGAACCAGGTGTACTACAACTACACTGCCGTCCACGGTGCGTAAGTGTGCACGATGAAAGACGTAGCTGTAGCAGCGTAGCATAGTTCGTAGT
TTTAATACCTTGTCAGTATTGAGTTCGTTATGGCAATGTGTTTGATGGAGTTCTGGAGTTCTGGAGTTCTGATCTCTCCGTGACAGACGTAAGTTACAGG
CTTGTTTAACCTTTGGAGGGGGGGGGGGACATTCTACCACTGTGGCATCTGTCACAATGCTGATCTGAAAAGCTTCAAACTTGACAAGTACATGTAACAC
TCAGGACATAGCTACTCGCGATCAAGAGTCTACAGTGCTAAAAAGAAAAAGGGAGTAGCTAAACTGTGAAAAGTATAAATCTGTTACATTAATCAGATGG
CCGATCTATGTCAGTACAATTCTTACCAGAAATGGTACACATACACTTTTCGGGACGTGACGGCCTGCGCGTCGATCATTACTGCGATCGCGTCACGGTC
GGCGGTGTCAATAACTCGGCTTTTAAAAGTTTATGTACAACTGTAGTATTTTCATTATTTATGGAGATTGTTGTGAAAAAACTAATTAATTTATTTTTAA
AAAAAGTCATCAATTTAGGCAAATCGTACAGTGCGAAATTTGATAACGCACGTGCCACTCACCCAGATACGAAACCGCCATTTACGAAGCTCCCACTGGT
GGTTTTGGATCTGTGGGAGTGTAGTTAGTTCGGACGCAGGTCGAATACTGTGAGCTGTGCAATATGCCGATTTTTAAAAGGCAGTATCTGTAATTTCAAA
TTACCTGATAACCACTACTTCTTCTAAGTAATAAAACTGAGCTCAATCTACCCGCTGTGCAACATCTATTTAGTCATCTATTCGAGTAACCACGCGGGGA
GGGGTGATCCGAATGAGCTTGTTAAACCGAAACTATGCTTGGAGGTTAAACCTGGGTTATCCGTAAGCAACTATACGCCAGGGGACAAGTATCGTTAGAT
CCCGCTCGATCTAAGCAACTGTCACTGGTGTCGTAGTTTTTGGAATCGAGGAAGGGCAAGACCAAACAGGCTATGGCACCCGTCCCAAATCGAAATTGGC
AACCAAGTTTCGGAACAACATCTAAACCCCTAAGATTGGCTAAAATTGGTCGAAGTTGAGCCCAATCTACGACATTCCAGAGCTTCTTCGTGCGCAGCAC
GACTTCGTGTCTGAGAACAAGAACTATGATGTGACATGAAATGAAATCGTGAAGTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCGACATTCCTATAGTTAAAAAGAGTAAATAAATTAATG
AAATTGTAAAACAAAAAGGTTAAAAGTATCTAATTCAATAAAGTTACCTTGGGTGGCGTCGACATTTTTAGCTCCAACGAACTCAATCGTCCGCTTCGGC
CCCATATCAATGTATATTGACGTCTGGTCCATGTTAAACACCGACTCGTACTTGTTTGGCCCCTTGATGCCTGAAAGTAGGCCGGCCATCTCCAGATTGT
ACTGAATGGTTCTTGAAAAATGATCCGCCACACCCTAATAATTTAAATAACAACGTTATTAAAAAAAATATTTTGATGATCTCACAACAATGTACCTGCA
ATTCCGAGCGCTTTTTGGTGCCTCTGTGGGTAATAACTCGTACTGGGAGACGATTGCGAAGGCGAAACCGTCTTATAGCAGCCACAGCAGTATCTAACGA
TCTTCCAGTAAGATACCGGGGCTCAAAGCGGACAGCCATGAGCAGTAGACACTGGCTTGTTACACCTATTCAGTTTAATTTTTAAAATTAACAATATTGC
ATGCCAGTAATTATTTATGCCACTTACACATTGACTTGTTCTTCCGCATATCGATAAACCACTCAAGAAGACTACAAATTTGTTAGTTTTAATTAACAAT
TATCAATTGTTAAAATAAAACATATACCGAGATTCTAGTCCGGGAAATCGTAATTTCACACCCCTCTTGACCTTGCTTATCTTCTTTTTCTTTCTGTTTA
CGCCTTGAGCGTCTTTAATTCGACCCTCCTCCTTGGCCCAGCGCCACAATGTCACACGGTGAACACCGTACTTGGCAGCCAACGCCTCTGTGGCTTCACC
CGCAGCTCGGACTTCCAGCACAGCCTATAAATGCACATATTGGAAACTAAAAATACATTTTCATCTACTGCGGAATGACTCTTGCTTACCTCTCGCCGTT
CTTGGTTGGTGCACTGGGCTTTGGTTCGCATTAAGACGCTCAAATCCAAAATGCGCGGGAAATTAAGATGGATGGCGCTGGTTGGTTTTGTGGCATCCGA
TCTACGTTAAAATATTTACGACTTTTTACCTTTTTACAAATTTACTTGGAGGTAACATTTTACAAAGTTGCGTTTTATTCGTCGAATCCGGTACAAGGTA
CCTAGCGATGTAGCGGAAGCTCCTATGCTCTGCATGCAGCGCTTTTGCTTGGCCGATCTCGTCGGCAGTGAGTTTGGCTCCTCGAGGCATCGTTCGGGCT
TGTTTCGAGGTGGCGCGTTCACTATCGTGCAGGCGGTTGTGGCTGTAATCACCCTAAACAATTTTTAGCCAATAAAAACGATTTTTGCAAGTGCTATCTG
GTTTTTTAAAAAGTGCGTCTATAATTTAGAACACTTCCCCAACTTAAATTTTTTTATTGTGTTTTCAATAACACTTCAACCACAA