Description :
From Genome Similarity Track
Location :
contig_7:577310- 579414
Transcript NameFunction/comments
g2587.t1hypothetical protein

Sequence
2104 bases(100 bases per row)
TTCTCACGGCCCTTCAAGTTAGTCACGGATGCGTCGAAGGTCGGACTAGGCGCTACGTTGACACAGGACCAAGGTAGCGGAGAGCAACCTGTGGCTTACG
CGTCGAAGTAAACTCGCCTAGCGGTAAAGTACAGTATTACGGACTTGGAGTGTGCAGCAGTAGTGTGGGCGGTGAAGCTCTTTAGGCCGTACCTCTACGG
TCGCAAGTTCGAGCTGGTAACGGATCACGCAGCACTCAAGGTTGATGACTCGAAGGACTTGTCGGGGCGTTTGCACCGCTGGGCATTACAGTTACAAGAG
TACGACTTCGAAGTGGTGTACCGACCTGGGTCGAGCAACGTGGTCGCAGACGCGTTGTCGCGAGCACCGATCCACACGGTGACAAGCCGCGAGGTCGGGC
ATCGAGAGAGAAGAGATAGCTGGAGATTTGCCGAGGCAAGGAAGCGAAGGACAGCTCACTGACGAGATGATTCGTGCACGGCAAGCGGATGACAAGACGG
TGCGGAAGTTGCGCCGGGAGAAGAAGTACGGAGGGCGCGCAATTGTAGTGAAGGACGAGCTGGTCCACATTCGAGAAAGCGACGGCAGTCTGCGAATAGT
CTTGCCGACAGCGTTGTGGCCCGACGTGCTGCGCGAGAACCATGACTCTATCTTCGCGTGTCACCTCAGGGTACCGCAGACGTACGCCAGAATCGCTGCG
CGATACTGGTGGCCCGACATGAGGACGCACATAAGACGGTGGGTGCGTGCGTGCAGGGACTGTGGCACACGGAAGTCGAAGGCAAAGGAGGTGATACCTC
CGCTACGTAGTCAAGGGATCGGTGATGTTGGCGATCGGTGGGCCCTGGACGTGGCTGGCTCACTTCCGCTTACGAAGGACGGCAATCGGTATGTGGTGGC
GGCCGTGGACTACGCTTCGAGATACGCTGTGGTGGCTGCAGTACCCAGCCACACAGCCAGGGACATCGCACACTTCATCATGGAAAAGGTCGTGTTGGTG
TACGGGCCCGTCCGAGAGATCGTGATGGACGGCGCGCCGGAGTTGAACGGAGCAGTAGTAGAAGCGCTGGTGAGTATGCTACAGGCCAAGCAAATCACAC
CAGTGCCGTATCGACCAGCTCTGCTAGGCTTGGTGGAGCGGTTTCACCGCACCTGGAAGGACATGGTGGCGATCTACGTGTCGGAAGCGCAAGACGACTG
GGACAGGTGGCTCTCGTGCGCAGCATACGCGTACAACGGCGCAAAGCATTCCGGTACGGGGTTTAGCCCCAACGAGTTGATGATGGGGCGGCGCCTCCGG
GCACCAAACGAGTTGTTGAGAAGCAGCGGAGTGACGCAGGTCGGGGCATTCGCAGATTTTGAACGGGCACTCGTGAGCAACTTGGCACGGGCAACGACGG
CAGCAAAGAAAGCTCTCGTCAAGGAGCAGCAGCGACGGGCGAGGTACTACGACAGAAGGGTGCGTCAGAGTGTAGTCTTCGATGTAGGAGATCGCGTGTG
GGTGCTGCGACCTCCGCGCGGCAAAGGAATCACAAAGCTGTCGCATCAATGGGATGGTCCGGCACGAATCATGGAAGACGCGGGCTTCGACAACTGGAGG
GTGGTGCGCGAGGACACGGACGAGCATATGGTCGTTCACTGTAGCTTCTTGGTATCGAGCCACTGTCCGAGTGACTCGCTGGGCAACGTGGCAGAACGGA
TTTTGAAGGAGGTGGCGGAAGAAGACGCAGACGTGAGGCCGGACGGAGAAGAGCAAGACGTGGGCGTGTTGGTGCTGGGGTCTACCGTTGTGGCAGAAGT
TGCTGGAGGATCAGAACAGCAGACAAGGTCGGAGGAGAACAGCGCGGTGCCGGTGGGCCAGTGCGAGAACGCGGCCCCTGTACAGCACGTGAACGCTGAG
GGCCAAGGCGGAGAAGTTGATATGGAAACGCAGCAAGCGCCGGATGCCGGCGCCCCAGAAATAGCACCAGCGGAGCGGCAGCGTGCGGTTGAAGTGCTGC
GGTAGTGCAAATCCAGTCGATGCAGCAGTTCGAAGCAAGCCACGGAAGAGGAAGACGAGAACGGATGAGCAACAGGACGCGCAAACAGCAGCGGCGACAA
GAAG