Description :
From Genome Similarity Track
Location :
Scaffold_1:5772848- 5781765
Transcript NameFunction/comments
Physo_553623hCG1793014, isoform CRA_a
Physo_446719Hypothetical protein
Physo_477232histidyl-tRNA synthetase, putative
Physo_478816histidyl-tRNA synthetase, putative
Physo_310807crinkler (CRN) family protein, putative

Sequence
8917 bases(100 bases per row)
ATGCCTTTCGCTAGGCTTTCCCCGTTGACATCTGAATCCACCTCCGACTCTTTGGAAACGAACAAAAAATTTGCATCCGGTCTACACCAGTCTCGTGTCT
TCCGCGCCCCGCCACAAGCGTCGACTCTTTCTAGGTCCTGCACGTGCCAATGCTATCCTCCCCCGTGGAATCGCCCAGCATGCGAGACACACGCAGCGCC
GCTGAGCCCAGTCTGGACCCGGTGGACAAGCGCCGAAGCGGAAGCGACGCCAGCGCCATCGCAGAGGACGCAGCGCCAGCAGACAAGCAGGAGGACGCCT
CGCACGTAGAGGCCGAGATCGAGCCGGAAGAGGCGAGCGACGAGACTGGAACGTCGAAGGAAAAGACGGCGGCTGACGAGCCAACCGAGCAGCCTGTGGA
AGCCGTTGACGCCGCTGAGGTTGAGCTGGAGGAGAAGCCGACGACTGCCAAGACGCAGGACGAGCCGGAGCTCGAGACGCCGAGTGACGACTCGTGGAAG
AACGAGGAGAAGGAAAAGCAAGAGCAGCAGCAGCAGAAGCGGACGCTACCCACGCGCCCTGCTACTGCCAGAAGTGCCGAGTCGGGCTCAGTCGTGCGCC
GGCCGTTTGTCCCGTTGGCGTCCAAGAGCTGGCGCGTGCGAGCCATGGAGTCCAACACGCAGATCACTCGTCTTATGAAGGCGGCGTTGCTGCAGACGCT
GCTGCACGCTATCCGCACTGGGTCGGTGGAAGGTGTGAAGGTCGCCATTGAGCGTGGAGTGCAGGTGCAGTACCTGGACAACCGCCAGCGCAACCTCGTC
ATGCTGGCCAGCAAGTGCGACACCGATGCTCGTCTGCACATTGCGATTATTCTGCTGGACGCCGGATGTGATATGAACCACAAGGACCAGCTAGGCTGGA
GCTGTCTGCATTATGCTTGGTATGTGCTACGTAGATAGTTCTTGGATCGCTATGTTTGTGTACTAATTGTTGCGCCGTGTGCGATTTGACTTACGATCAG
TGCTAGCGGAGCCGATGATGTGGCTGCGGAACTCATTCGACGTGGAGCTCGCGTCGAGTTCAACCCGTACGGATACGGCCCCGAAGACTTCAACATCCCC
AAGGTGGCACGTGCGAAAAGCCTGCTGCAGCACACGGAGCAGCTGCAGCACGAGCAAAATGTTTGTGCAGCCTGGGCCTTCTTCCGTCGCCAGGCGGAGA
AGACGGGCTACAGTGTCAAGTGCAAATCGGTATGCGGGCGGCAAATAGCTGTGATTGATTCATGCATCTGCAAAAGCACTTACAAATTTTTATATTTCTC
TTCTGCTGTAGAACTGCGATCTTGGCAAGCCCCTCAAGATTACGTTCCAGGCCCCTCCTGGTCACAGTCCGCTTGACCGCATCCGCGTGGTCGACATGAA
CTCCGATGTGGCACTGTGGCTTCAAGTGTCCAAGACTTTCAGCATCCCTCCTGGCGATGTGGGCACAATTACGCTGGACGTAGAGACACTGGACCGACCA
TCACTGTATCGTATCGTTTACGAGAAATACGAGCCGACGCCAATTCAGCTGCCAACCTCGGTGGCTGAAAGCAACTTGTGCGTCAAGAACCTTGACACGG
GAACCACTGTCTCGATGGGAAGTGTCAACAACTTGGTTCTGAAAGAACTTAAGAGCTCACGGTCGTCGAAGAAGTCCAAGAAACTGTCGAGCTCTGCCAG
GTAAGCAGTGATGTGCGCAATAGCTTGGTGTATCAAAATTTGTTCTAACGAAACGGTATGATCTCGCTTACTAGGCCAGCACCGAAGTCGGATAAACCTT
CAACGGTTGTTCGGAGAGGATCTACTACGTACGTATTATAAAATCGCTACGTGCGGGCGCTGGTGTGCTATTAGATCTGACGTTTTAATGTATGTTGCTT
GTACAGCCGAGCTCGGGAGATCACTGAAAGCGTGTGTGAAGCCACTGTGGAGGAGGAATATGAAGGAGAAGAAGCTGAGTTTTCAGCTGATGAGACGATT
ACTACCCACGAAGTCGCCGAGCACCCAGCCGTCACGAGTATCACGGGTGTGTACAAGATTGTGGCAATGGGAGTCGTTAGTGTTTCGACACTGAGGACTG
CCAAGGCTAACGAGTATGAGATTTCCATTAGTCGCAAGGGCCCTCTTGGACTTCAGCTGGTACGATTTTCGCGAATTGTGTTTTTGTTAGCACCAATTTA
GTCGTCTCACTGATTCTACTTGTTCGTGCGTATAGGCGCCCAAGCTTGACGGCTCCAAGAGATCGCCGCGTCTCATTGTGCGACGTAGTCAGGGCCAAGC
TGCAGCTGTGAACCCGGGCGATTGCCTTGTTGCGATTGGCAACGCGAACATCGAGCACGCGGGTCTGAAGCACACGCTGTGGGCGCTGAACGATGCGAAG
CGCCCACTTGTGCTGCGCTTCCGACGTGGCAACGCCAAGGAAAAGAGGAGTCTATTCAAGGCAGGTCTGTCCAAGCTCACAGGACCTCGTAGACAGCCTG
TCATCGCGGTGTAAACCTGTGGTAGGAACAGCTTTTTATTTTTTTATTTTTGATAGGATGAACATGAGGTCGAAAGCATGAACCTGAGAATCAATGAAGC
GGTCAAGGTGAAGCTTACACAAAGTGAAACTTGTTCTGCTCATCTACTATCTGTCGCTAGTTTTACTTCTCAGCGGGACAGGAAGCACGAACTGGGAACA
AGGCTACAGCATGGGGTGGCCTTTGTCCACGTGACAGTATTTGAACGTCCTGTTCTGAATGGTGCACCGTCGGCATAGTGCGCCGGGTTTGGTTGACACG
TCGATCACGTGCAACGGGTGTGTCTATACCAACGGGAACATCATAACCATTCTGGCTGTTAGTCGCGTCCCTGTTTTCGCTATCGCACAGGAAAAAGCTC
ACCCTGAAGTGCTCAACCAGATCGTCGGGGTGGATTTCTGTGCGGGTATCCGTCTCAGGATCGTACACGATTGCAGGGTCTGCCGTCAACGTTTAATTAA
ACGGAACTGTTAGCTGCGATCCCGTCTCTCAAGAGCTCAGCCAAAATATATCATACTTACATTGCTTGCCGTCACCCCGCCATATATACCACGCTTGCGC
CTCCCACCACGCTGGTTCCTGTGATCCAACATTCTGATACTGTACGCAGACAATTGAGCAATCCGCCGCCACCAAATTAGTCCCCGTGCTTGGATTCTGC
TCGTGCAAGCATAATTGTAACCTACTGCGATTGCTAGCATCGAGCCTGGCCGTAAGGAGCTTGCCCACGTTTTGACGTGCTCCAAGAAGTCCTTTGGAGC
TTTATCCGCCGCGTACTTCTTCGTCAACAGCCACTCGCCGTCTTTTCCGTTCCCGCGCCGCTGAAGCCATGGGTTATGACCATGAAATGTCCACGTGTTC
GGCAGGATGATCCGATGCGGCTCGTTCGGGTCCACACAGATAGTGCCAAACGCCCAGTGCGGGAACTGCTGTCTCATCGCTCCTGTCTTGTAGCCTGTGT
AGTAGACGAAGATCTTGTGCACACACGTCATTTGGTTGTGCATGAATTGTGACCACGACTCAGTCGCCTTGGGCTTCTCTTGCTTGAGCAGCTTGCCCTG
CTCAGCTTCAGCCATAAATTCCCCCGTTGCCTGCTTGGCCATGACCTCCACGTCGTGCCGGAAAGCTTTGTTTGCCTGTCATTCAGCAGGCCACAGCACA
CTCGTCAGCAACACGACTATCTCGCAGTCTCCTTCCTTCAGCAGCACGCACCATTCCCAACCGACCGAGCGCAATAGGCGGCAGGAACGCAGCAATGTGC
AGCTTGAGCTCGTAGTTGAGCTGCTGGATGTTGGTCACTTTCTGGCTCTTGCGCGTCTTGGGCCTCGCCGCAGCGACCACTGCAGCCTTGGTGTCCGCTC
GGCGCTTCTTGGCGGCTGCCTTTCCGACCAGGTTCTTCTGAAAGTAGGCGCTCTCCACGCGCAGCATGCAGGAGCAGACTTCGCGGCCGTTGCATCGACG
CGTGTGGCGCACGAGTTTGGCGTCAATGGGCGCGATCGGCGCCTTGCTCGGGCTCGCGGCGTCGGCCGCCTCCTGCTGCTGCTGCTGCTCCTGGTTCATC
GTCGAGGCTTCTGGCGTCGCCTCGAGTGTCCGTACACCAACCAGCAGATGGGGCAGTGCGATTTGATTCGCCAAAAATACGCCGCAACTTACAAGGCGAG
TGAAGTGAGAGGCTGACGATGCTGGGGCTACGGCTGCGGTGCTCGAGGCCTGTGCAGGCGAACGGGACGCGGCGCTGGCTCGCGGAGGCCGCCAAGCCGA
AGGCCGTCAGTCGCGTCAGAGGCACCAGGGACTTGCTGGCTGACGACTCGCAGCAGCACCGCGAGGTCCTTGACGTGCTGCAGCGCACAGTCGAGCGCTA
TGGATTCCGCTCGGTGCGTGTCAATCGTCCGATCAGTGCGTGGTTTGGCGGACGCGTTCCTCTCTGACAATGTACACTACGTGCAGATCCAGACGCCGCT
GCTGGAATACACGGATTTGTTCTCGCGCTCGCTGGGCGATGGCTCGGACATCGTCATGAAGGTGGGCTACAACTTGCTCGGTATTGCATTTGATGACGAT
GGATTGGGTATTAACACATTCATGTCATTTGCTACGTTTGCGATTGCAGGAGATGTACACGTTTAAGGACAACTCGGGCAAGAGTGTGACGCTGCGACCT
GAAGGCACTGCCGGTGCGGGTTGGATGCACGGGAGTCCGTTGGTACTGCGTCGTTGCTGAAGGTTTTCGTGCGTGCGTATAATACGTTGCAGGTATTATG
CGTGCACTTGTGAGCAACAACTTGCTGTTTTCGCTGCCGCAGAAAATCTCGTACTCGGGCAGCATGTTCCGGTGGGTTGTGCTTTGGGTATCTTTCCTGG
TTGAAGTTGAGTTTATTATTGAACGCCGACTGGTAATGCTCGATTGGGTGCAGATATGAACGTCCCCAGCGCGGAAGGTACCGAGAGTTCCAGCAGTTCG
GTATGTTCTGTAGCATATCTTTATGGTTATGACTTTGGTCTAATGTTTCCATTGTACGTTGGTTAGGCGTGGAATTTGTGGGTTCTTCGGGCCCATCGGT
CGATACCGAGGTATGCTGGATAAACACATTTGCCAGGTTCCTTCATGATCATCTTACGCAGCTCGGGTGAACCTCGATACAGGTCATCGCAATGGCTGCT
GATGCCTTGGAAAGTTTGGGCATTAAGGACAAGGTCGTACTGGAGATTAACTCTCTGGGTGACAACGAAAGGTGACAAGCAACTTAGCGCAATACATTTA
GAGGGTATAATAATGTTTAACTGATGTCTTGTTATATCTGCAGCCGCTCAAGGTACCGTGCGGCGCTAGAAGCTTTCTTTTCCAAGTTTAAGGACGAACT
ATCCACGGATAGTATCAAGCGGTGAGTTAGTTAGACTTGGACGCTCTGTTGCGTGCTTACTAACGGAGTTCGTTTGAAATGGTTAGCCTCGAGCGAGGAA
GTGTTCTCCGAATTTTGGACTCCAAGAGTGAGGCCGACCAAAAGATTATTATCGACGCTCCTCAGCTTAAGGATTTTCTTTCCGACGAATCCAGAACGGT
AGGAGGTTATGTTTGCGGTTGCTGTTAATGCTATCCGGCTGACGTTTTATTTTCACAGCGATTTGATCAAGTTCTCGGTGGTCTGGATGCGTTGAGCATT
GCCTTCCAGCACAATCCTCGCCTCGTGAGAGGGCTGGTGCGTTCTTGTGTCATTGGATCGAGTTCAGGCTAGTTAAAGGTACTGATTGGTCTTCGTTCAC
GGTGGCAGGATTACTACAGCAACACTGTTTTTGAGTTTGTTGAAAAGCCCGCATCTGCAGCTTCTAGCAGTGTGGAAGCAACAACAGGAGGGATTGCAGT
GCTAGCTGGTGGCTGCTACGATGGTCTCGCAGAGTCGTTAGGAGGGCCTGCGACAGCTTGCGCGGGCTGGGCTGCTGGAGTTGATCGGCTTAACCTGCTT
CGAGAGATGCCAATCGAGACTGCGATCTCAGTCGCGGTACGCAATCTACACATCGCCAAGCTGGAAAATTTGTTTTCGTTGTCTAAGGATACTTCTTGTT
TCGATTAATGCTCCACAGGTTGTTCCGGTTCTTTCAGGCGATGATTCGAGTCGAGTGCTGCACGAAGCCATGCTAGTTGCTCAGGTAAACAGATCGACTG
GACCACACGCTTTGCAAGGCGGTCTCCACTCATACCTTCTATGTCTCATTTGTGCAGACGCTTCGTCAGCGTGGCCTGACGGTTCACTTTTGCCATGGTC
GCGGGAATATGAAGAAGCAGATGAAGGTAACGAATGCTGTGCTCTGTGTATGACAACAAGTGCATCTCGCTTCACGTAGACTAACGCCTCGTTGTTCATC
TTTAATGCTGCAGGCTGCTGAACGCTACGGCAGTACCCATGCTGTGATCCTGGGAGGTGCGGAAATCGAGCAACAGAGTGTGAAGGTCAAGAATCTCGAG
AAGCGAGAAGAGGCGGAAGTGTCGTTGGTTGAGCTGGGTAGCTTTGAGTTTCTCTGAGAACATCATAGGAAGGGCCGCATAGACATCAATAGAGCTTGAC
CACTTCTATGTGAAAAACCTCGATCCTATTGTCTATTTCGTGGAATTATTGTGAATAATAATCGCACAAAAACCGGGCGATGGCACGGTTTGAATACAAA
TATCAAGACTAGCGCGCTCGACATACATCGCCCAAGAGGTTATTCTCTTCGCGGGTCTGCGAAACGTTTGAAAATGCAAACCAGTTTGGTACACAAGGAC
ACGATGGAGGAGCCCCCGGCCGAGGAGCTCCGCCAGGACGGGCAGCAACAGGAGCTGCACGAGGAACACGAGCATGAGCAGGAAGATAAACCCTTGGAGC
TGGCCCGCCAGGAACCAGAGCCCGAGGAGATGGAGGTGTGGTGCTTGATCGTGGGGATGGTCGGGACGGCGTTTCCAGTGACTGTCAAGGGAACCGATCG
CGTTTGGGAGCTACAGAAGACGATCAAGAACGAGGCCGTGGAGATCTTTGGAGACTTTAACGCCGCTCAGCTGCGGCTGTATCTGGCCAAGAATGACAGT
GGCCAGTGGCTCTCTGCAGCCGAGGTGCAGGCTATTGAGAACGGCGACGCGCGGCCAGCCCGATCCTTGCTGGCGAGAGGCCATTTGGCGTCGATGAGTC
AATTGGTTGGAATTTTGAAGGGCCGTGACGCAAACTCCGTCCACATTCTGGTCCCAGCTCCGTCGAAATCATCGGAGATAGAGGTTGAGCCTGATATCGC
TGGCAAGAGGAAGCGGTCGGAGCAGTCATTTGGGGAGGTGGAGAAAATCGGGGTATCCGCTGAAGAGTGGAAGTTTCTGTTTGATATATTGAGACAGAAA
AGACAAGCTGGGCCTGGGGCCCAGCTTGTCTTCTCTGGATTTGTTGCGACACAAACCCTGCACGAGTTCTGCAAGGGATTCGGTGGCTTTCCGTCGTCTT
ACTTCGTACGGCAGGAGGGACTTGTGCTTTGGGGGCTGGTCATGCGGATTCTGTCGAAAAGAGAGAAGCGGGTTGTGCTTGTGGGCTCGGCGGGTGTCGG
CAAATCGTGCTTTGTTATGCTTGTAAGTCTTTATGTGGCGCTTGTCGAGAAGAAAAAAGTTTTGGTGGTACGACGTCTGCGGGGATTTTCAGAAGCGAGT
GCAGTGGTCTACCTTGATGGTGCGAAGGGCTCGTGCATTCGAATGGCGAATCTGACGTCTGCAAAAATTGCTTCGCTTCCTGACAGGAAAGAATTTCAAG
ATGCTTTCGTGTTGATTGATGGCTATTCCAGAAAGGAAGCAGGCCATCTGTTTGGCTTGCTCCCGTTCCAACTCATTGCGTCTCCAATGGAAGACGATAT
TTGTTTTGACGACTCAGCTTGCGCTGTGGTACTACCAGGATGGCAACACAGTGATCTACTTCAATATGCTGAATCGAAACCGGACGACTGGAAAAGATCG
ACGGGATTTGGCCACGAACAACAGAAAACCGTGAAAGAACTTGTGGAGGCACAATACTTCTATAGTGGTGGAAGTCTCCGTAATTTTCTCAAGCATCGCG
AAGATGTGAAAAACGGAATAGATAGCATCTGTGGCATAGTGGAAAATGCTCAATCGGTTGACTTGGAATCGCTGCATCAAGCTGGTTTGCAAGTGAGCGA
GTCATATGACCGAGTTCGGCGGCACTACGTTCTGGACCCCAACGATGAAGACCACTATTGGCACGTGTGCCATTGGCTAACCCAGGTAGACTGCGGATAT
GCATTCAAACGGATTGGACGCTTTATGGACTGGGAAAATCTCATTGGGAACTATGAGTGTGCTCAAAAAGCCCGATCTGGATTTTGTGGCGCGGCATATG
AACAATGCTTTCATGGTGCGCTCCACCAGGCAACGAAGTGGTATCCTGTTCAGATGGTGAACGTCGTGGTTAACTTTGACCCAACGTGCTCGAACCAAAG
GTACGATCGAATCGAGCTGGGAGGCCAGTCTGTTCAATGTGAGGGTACATGCAGAACGGAGGATAAGTGCTATGCACACATGCCTAAGCTCGCCCCGGGA
ACATATTGGCATCCTGAGTGCGTTGAGTTCCCTTTTGTCGACGCAGTGGTTATTTGCGAGGCCACTCTGCGAGGGAGCAGTATGAAGGAGAAGATTGTGG
CCTGCGTCAGCACCACTGTCGGCGATCGGAAGATATTCCAGCCAGAGCTCTGGCGGAAGTTGAAGGAGGCTATTGATGAAAATGATAGCATCCCCACGAG
CGTTCCCCGAGTGTTTGTCATTGTGGGTCCTGACGCCAGTACCTGCAAGCGGTTCACCTTGGTTGATGCTCCCGCCCCAGACGAACATATGGTGTGCTGC
TTCGACCCACCTAAGTT