Description :
From Genome Similarity Track
Location :
contig_7:577241- 579408
Transcript NameFunction/comments
g2426.t1hypothetical protein

Sequence
2167 bases(100 bases per row)
TTTAAAGAGGCGTTGACGAGGCCGGTGTTGGCGTACCCGGACTTCTCACGGCCCTTCAAGTTAGTCACGGATGCGTCGAAGGTCGGACTAGGCGCTACGT
TGACACAGGACCAAGGTAGCGGAGAGCAACCTGTGGCTTACGCGTCGAAGTAAACTCGCCTAGCGGTAAAGTACAGTATTACGGACTTGGAGTGTGCAGC
AGTAGTGTGGGCGGTGAAGCTCTTTAGGCCGTACCTCTACGGTCGCAAGTTCGAGCTGGTAACGGATCACGCAGCACTCAAGGTTGATGACTCGAAGGAC
TTGTCGGGGCGTTTGCACCGCTGGGCATTACAGTTACAAGAGTACGACTTCGAAGTGGTGTACCGACCTGGGTCGAGCAACGTGGTCGCAGACGCGTTGT
CGCGAGCACCGATCCACACGGTGACAAGCCGCGAGGTCGGGCATCGAGAGAGAAGAGATAGCTGGAGATTTGCCGAGGCAAGGAAGCGAGGACAGCTCAC
TGACGAGATGATTCGTGCACGGCAAGCGGATGACAAGACGGTGCGGAAGTTGCGCCGGGAGAAGAAGTACGGAGGGCGCGCAATTGTAGTGAAGGACGAG
CTGTTCCACATTCGAGAAAGCGACGGCAGTCTGCGAATAGTCTTGCCGACAGCGTTGTGGCCCGACGTGCTGCGCGAGAACCATGACTCTATCTTCGCGT
GTCACCTCAGGGTACCGCAGACGTACGCCAGAATCGCTGCGCGATACTGGTGGCCCGACATGAGGACGCACATAAGACGGTGCGTGCGTGCGTGCAGGGA
CTGTGGCACACGGAAGTCGAAGGCGAAGGAGGTGATACCTCCGCTACGTAGTCAAGGGATCGGTGATGTTGGCGATCGGTGGGCCCTGGACGTGGCTGGC
TCACTTCCGCTTACGAAGGACGGCAATCGGTATGTGGTGGCGGCCGTGGACTACGCTTCGAGATACGCTGTGGTGGCTGCAGTACCCAGCCACACAGCCA
GGGACATCGCACACTTCATCATGGAAAAGGTTGTGTTGGTGTACGGGCCCGTCCGAGAGATCGTGATGGACGGCGCGCCGGAGTTGAACGGAGCAGTAGT
TGAAGCGCTGGTGAGTATGCTACAGGCCAAGCAAATCACACCAGTGCCGTATCGACCAGCTCTGCTAGGCTTGGTGGAGCGGTTTCACCGCACCTGGAAG
GACATGGTGGCGATCTACGTGTCGGAAGCGCAAGACGACTGGGACAGGTGGCTCTCGTGCGCAGCATACGCGTACAACGGCGCAAAGCATTCCGGTACGG
GGTTTAGCCCCAACGAGTTGATGATGGGGCGGCGCCTCCGGGCACCAAACGAGTTGTTGAGAAGCAGCGGAGTGACGCAGGTCGGGGCATTCGCAGATTT
TGAACGGGCACTCGTGAGCAACTTGGCACGGGCAACGACGGCAGCAAAGAAAGCTCTCGTCAAGGAGCAGCAGCGACGGGCGAGGTACTACGACAGAAGG
GTGCGTCAGAGTGTAGTCTTCGATGTAGGAGATCGCGTGTGGGTGCTGCGACCTCCGCGCGGCAAAGGAATCACAAAGCTGTCGCATCAATGGGTTGGTC
CGGCACGAATCATGGAAGACGCGGGCTTCGACAACTGGAGGGTGGTGCGCGAGGACACGGACGAGCATATGGTCGTTCACTGTAGCTTCTTGGTATCGAG
CCACTGTCCGAGTGACTCGCTGGGCAACGTGGCAGAACGGATTTTGAAGGAGGTGGCGGAAGAAGACGCAGACGTGAGGCCGGACGGAGAAGAGCAAGAC
GTGGGCGTGTTGGTGCTGGGGTCTACCGTTGTGGCAGAAGTTGCTGGAGGATCAGAACAGCAGACAAGGTCGGAGGAGAACGGCGCGGTGCCGGTGGGCC
GGTGCGAGAACGCGGCCCCTGTACAGCACGTGAACGCTGAGGGCCAAGGCGGAGAAGTTGATATGGAAACGCAGCAAGCGCCGGATGCCGGCGCCCCAGA
AATAGCACCAGCGGAGCGGCAGCGTGCGGTTGAAGTGGCTGGCGGTAGTGCAAATCCAGTCGATGCAGCAGTTCGAAGCAAGCCACGGAAGAGGAAGACG
AGAACGGATGAGCAACAGGGACGCGCAAACAGCAGCGGCGACAAGAAGCTGATGCGGCACGAGAAGT