Description :
From Genome Similarity Track
Location :
Scaffold_44:57720- 58839
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09339Avr4-associated TDF-like protein

Sequence
1119 bases(100 bases per row)
GGGTGCAGACCGAGCTGGCCCGGCGACGGCTCGCCCGTGACTTCGCCAAAGTACAAGGCAAACGTGGCCTTGAGCTCCTCAATCTTGGCGCGGTCTTCCA
TCCACGTCTGGAACGCAACCGAGTTGGCGCGCTTGATGTCCCAGGGCTGCACGCCGCTGGCCGGCGGCACGTCCGTGCGCGACGAGAAGCCGGCCATGAG
GCTCGACTGCACCTCCTTCGAGACGATCCAGTTGACAAAGAGCTTGGCCGCGGCCATGTGCGGCGCCTTCTTCAGAATCGCAATGCGCTGGCCCCACGCG
AGGTAGTCGGACGACGCGTTGGCGCCCGTGATCTCCTTGATCGAGCTCGAGTTGGTCGCTGGCGCCGAGCCCGCGACGCCGATCGCCTTGCGCTGCGCCG
TCACCGCGAGGTCGGGCGTGTGCGAGCCGCGCTTGAACTCGATCTGCTGCGCGGCGAGCTTCTTGACCCAGTCCCAGCCGTACGCCTTGACGTAGCGGTC
GTAGATGAACAAGGTCGCGTCGTCGTCGTGCGGGTATGCGGACGCGATGAGACCGGCGTACTTGGGGTCGGCGAGGTCCTTGGCCGTCGCGGGGGGCGAG
AGTCCCTTCTTCTGCAGCAACGCCTCGTCGTAAAAGTAACTAAACGTAAAGACCGCGTGCGAGAGCCAGTTGCCGTCGGGGTCCGTAAAGCCCTTGTAGA
CATTGCCAAAGCCGTTGGGCTTGTACGGCAGCAGCTTGCCCTGCTTCTTCCAGCGCGGGTAGTCGTTGAGCGTCTGGAGCGCAACGACGTCCGCGACAAG
AGAGTTGGTCTCGAGCTGGTTGTCGATGCGCGCGTTGTGGTACTTGCTGTAGTCGACGACCATGGTGAGGTTCATCTTGGGGAACGCGGCGCGGAAGGCG
TCGGCGACGTAGTCTTGCTGCTGCGCATGGTCACCGCCATGGTACACGACGAGGTTACCGCCTTCCTTGAGCGCTTCTTCGTACAGCGTCTTGATCGACT
TGGTCTCTTCGCCGTTGCCCGACGGCGGCGCCTTGGTCTTGCGGTACGCGCTCGCGTCTTCGAGAAGGAAGAGGAGCGGGAGGAGTGCAACGAGGCGGAA
GAGCTGCATGTTGGTCGCT