Description :
From Genome Similarity Track
Location :
Scaffold_832:5772- 6799
Sequence
1027 bases(100 bases per row)
GCATGGTGAGATCACTAGGAGCTCAGTGGGCAGTCAGAATCCCAACAGCGCGGATGTTCATGCTTGCTACTCAATTCGCCAGTCGCCAATCCCACAAGGG
GTTAAAGAGTATCTAGAGTTGAAACAATCGCCCAATCCTTATAGGGATCATGTTAACCGACCCCATATAACCCAACAAGGCATTCCCATATGGGAACAAA
TGCTCCAGCAACGTTATTCACTGTCGTGGTTAGATATTACTCCAATATCGCACCGAGAAACACGCCACCCACTGCCCTACCCCATTCTTGATCTCACTGC
CTTCGGTACACAGCGAAGTGAACATATGCCGCCGTGGTGGACACTTATGCGGAGCTAACTCGACCGTCTCGGGCTGGCTGTTTATGAAGCTCCCAAATGA
TGGCGACACTATCTTACCATGACCACACGTAGCTAGATCTGGGCACAAACCCTTTTGTATACGACTCGGGGCGTGAAGACACTCCAGGTGCAATTATTTC
GGCGTACCTGGGAGGATCATTAGAACTACACTTACCACGCGGCAGTGCAAGAGGGACAACCGAGTGCGACACTATGGCGCGATGTTAACACCGGGATTCG
ACAGCGGCGTGAGAGCCACGCAAGTCGTACCCGTAATCACATTTCTCGACTGATTACCACCCGCAAAGATAAGCTGAGGGCAGTGCAATCTGGCACCAAT
CTCGAGAACGCGCCCTACAAAACTCAACGAATACTGCCGGCTCTTCCGAAGACTAATGCATATTTAGTGTGTGTCAAAATGGTCAGAGACAACCTGACCT
TACACGTCTGGGCTACTACCACGGGGTCCTTGTTGGATCTTCCGTATACGGCCCCACTGCTGTGCGCGGCGCCGGGTGTAGATAGCCGTCATAACCGCAA
TTCAATTCAAAACTGTTGTACAGCTGAAATCTAGGTAGATGCAGATTGCACAAGCCGAGCATATATGCTGTTtagttgcagcagctcctggtgCGTGCCC
TGCTCCGCGATTTTGCCGCCACTTACA