Description :
From Genome Similarity Track
Location :
contig_19:577127- 578963
Transcript NameFunction/comments
g4432.t1hypothetical protein

Sequence
1836 bases(100 bases per row)
TTCAGCGACGGGGAAGATGAAGCTTGTAGGTGTGTGCAAGTGATGCTGTCCCTTTGGGATCTCCTCACACTGCAATAAATCAACGAAGTCGCTGTTTCTG
TTCAGGAATGAGCACATATCGATGTTGTGCTCGGCTAATGTCGTGCGCTGTGTAGTTACCATCTGCCCGCTTACACCAAAATCACGCTCAATCTGGCACG
AAGATACTGGTATTGAGAACAGCACTCTCACAGCTTTCGGTATGATACGGTGTCGCCTTGGTGCTCAAGTCTTTGCCAAAACTCAAGTACTGATTCATTT
GGTGTGTAGTCCTCTTTTCGTGCAATGTCGACAGGATCTTCCAGCCATCGATCAAGTTCCTCTTCTGCGCGTCGATCCTGCCGGCTAAAGGTTGGTGGTC
GGCTTGATCTCGGCGCAAATTCTGCTTCCAGTCGACTGACTTGCACAACAGGTGCAGGTGGTTCAAATTCAGAGACGTCCGCGGGTTCACTTACTGCCTT
AAGTAAGTCCAATAAGTTGCAGCGGATTTTGGCGTTCACATCATTCTTCCTGGTCACAGCATCCCTTCCGCTTTTGCCATGCTGACGGCACGACAAAATC
ACTGCACGATCGAGGCTCCTCTCCGTTCGTTTGAAGATAGGGTGGAGTTTCAACTGCATTTCAAATACAAATTGACACTTGTGGAATTGCTTGTCGTTGT
AATATCTGCTGAAGAAGCGTTCGTCCAATGCTCTCCGCAATAGTCTCCGTACATCCGCAGCCAGTGGTGTAAGGTCACTTGCAGGAATCCAACGAGGATT
TTTGTCGGTTGATAGGTAGTGTGGCAAAGGCTGATCAGGGTCGAGGTCGTGAATACGCATCATATACAACTGTACGAGCACGTCGACTTGAACAGGATGC
TCTGCTTGACATGTTCGCTTGATCTCACCGATTTGCTTCAGCACAGACAACACATGAACCAAGTCGTCATGGCGATTAGCCAACGGGAACTCTGGTGGTG
GCTGGTTGGCACGAAGTGCTTTACGAGCTCGCTCTTCATACCACGCAGTTATTGCTGGCCACTTCTCAAGAACTCTCTCCAATGAACGCGTCATGCTCAG
GAAACGTGAAGTAGAATATCCAACAAGTCGCGTGGAGGCACCCTGAGTCTTAGACTTACAGAGCTCTGCAAATAAGCTCCCAGTGACAGACACGACCTTG
ACCTGAAATATTGTTCTTACCATCCGTGAGATTAAGTCCGCCATCTCCGGGTTAGCTGCAGCACTAGCAGCTCCATTTACACCACATGATGACTTTGTAG
CTGCGTGGGCCATGTGTGCGAAGCACCACTCCCAGTGCAGATTGAGTTCTTTGCACAGCATCGATTTCACGTCACCCCCGAGTCGCTCGTAGCCCCGTAG
AAATCGCTCGTCGCTAAGCCAAAGTCCTCGAGCATGTGCTTCAACCACCCTTTGAAGGGCTTGACAATGCCGCCATCACGATCTCCATATGCGGGGTTGA
ACTTTCTCGTTCCCAAGAGAATGGACTTGTACTCCCAGGCCTTGTCCACCAGGTAAACCCGCAACCCAAGAAATTTGTCTTGCGTTGTTTTGCAAGTCCA
AAAATCTGCCACGAGCGTAAAGTTCGGGTAGTCCTCTCGGTTCTCTTGGAGGTAGTTAGTGATCTCCTTGCGTGTTGAAGAATACAGCTCCACGATAGAT
TCCTTCACCTGCTTTGTAGTTATCTTGGCCTTCATCTCGTCCTTATAGAGTAGCGCTTGGATTAGTCTTGCCTCTTCGTACTCCACCATACGAAACGTCA
AGTTATGGTTGATGATCATGAGAGTGGTCATCAGCA