Description :
From Genome Similarity Track
Location :
Scaffold_77:57709- 61472
Transcript NameFunction/comments
Phyke_g3255hypothetical protein PHYSODRAFT_543861

Sequence
3763 bases(100 bases per row)
ATGGACTCCGAGGGCTTCACGTCGCGCGCATGGCTGGGCCATTGGGTGTCTGGAGAGGACGAGCCTGTGAACAATTACTACGAAGACCACAAGCTCATGG
AGGGGGCTCTCATCAAACTAGGCGACTACGCGCACTTTCGCTACTTCCTACTGTTCCGCAACGGCCGCTTCTGCTACTACGAACTTCCCATGCCTGCGGC
TGCACCTAGTGGGGGGCCCGAAGGCCCCAGAAGGGTCCATCTCACTCTCACGTCCAAGCACCTGCGCGGTGTCATGATGCTCAACGCGTCAGTGAACGGC
AAAGATTTGGCCAAGAGCGAAGACGAGTACGGTGCTGATCTCCTTAAACGAGGCCTCGTGTTCAACCGCAAGAAACTGGAAATGCAGCTCACTGGGTTCT
CCCCCACAGGTCAATTGATGTCCTGGAAGCTACGAGCAGGGAAAGATGCAGTTTATCTCAAATGGGAGCGAGCTTTTCGACTGGCATTGAGACCAATTTG
GGTGCAAAACTCCAAGTACTGTATGGTCTGCAAGAAGGACTTTAGCTTCTTCATCCGGCCGCATCACTGCAGGTATATTTACGTTTTGTCATGTGACTAT
ATTATTTGTGACAGGATGATCTAACGATTCGGACGtattgttgtttgtttgtttgttgttgttgctgcttttaTTTCTGTAGGAAATGCGGGACGTGTAT
GTGCGACGAATGCTCGGTGTTCGTCCCCCGGTTGCCAATACAGGGCTATTACGACGAAGTGCGCATCTGTAGAGACTGCTCACCAATCAAAATCCAGCGA
TCAGCGTTGAAATTGGGCACACAAGTGCTGGTATACGGCGTTTTAATTGGTCGTGTGGCACAAgtggatgctgctgatgatTCGGACGAAGGAAGAGCGT
TTGTGAATGTGGagctggccaagaagaatAATCAACTGCGGCAGTTTGCGCTAGAACACGTGGAGCTCTACTCTGACGCGGTTTTGTCGGCGAATCGCAT
CAAAAATGCCATCCGACAACACCTTTCGTATGCTGTGTTCCGTACGCAActcaacttcaacacatGGAACTTGCTGGAGACTGTGCAAGAACAGCGCACT
GTGCAAATGGTGCGGATTCTCAACAAGTCCACCAGTATCAACGAGCTTCATTCCATGGTCCCGATGCTAGGCTCATGGGACACAATGCTTTGTCCTGACG
ACGATATAACGGAAAAGGAGCGTGTTAAGGCCTCTCTTGCGCACTATCGTGGTGTGCACGTGGGTTTTCCTCTGCGTCTTGACACAGTAAAGAGGTTGAT
CAATCAATTCCGCAACGGAATTTTGTTGCATCGCGTTTTCGTTCGTCAGATTCTGGATGAGTCAGAAAAGCTGTTCCGCAAGAAACACACTTCACCGATG
AACAACATTGAAATCCCTGTGGGCGTGCAGTTAGTCGTTGTGGGTGACCTTCACGGGCAGTTGGAAGATTTGCTGACGATAATGGATGAGAACGGCGCGC
CAAGTAGCAAGACGTGGTATGTCTTTAACGGCGATTTTGTTGATCGCGGGTCACACGGAATCGAAgttatgctgctgctccttaTCTTCAAGCTCTTGTA
CCCCGATTTCGTTTTTTTGAACCGCGGCAACCACGAAGAGCGAATGATTAACGAGGTCTTTGGTTTTGAAGATGAGATATATACGAAGTACGGCacagac
aacgacgatgttGCTGGGGGGAACGGGCTTGGCACATCACTCAATTACTCGCCCATGAAGCTTTTTCAAATGTTCGAGACGGTATTTGGTTTGTTCCCGA
TCTTCGCGTTGCTGAACAAGCGGATCTTTATCGTACATGGTGGTTTAAGCAGCCATGAGAACGTCACGATAGAGGAACTACTCCAGCTCAATCACCGACG
TGAAATTCCGACACAAGGGACAAGCCGCGCTGACGAAATTTTCACGCATCTATTGTGGAGCGACCCGCGCGATGAGGATGGGTGGAAACCATCAAGCCGA
GGGGCTGGCGTGGAATTTGGGCCTGATATTACCAAAGCGTTTTGCACGCAAAATGACATCAGCCTCATTATTAGATCGCACGAGTGCCGAGAAGAAGGTT
TCGATATTGTACACGATGGTCTGCTTTTAACAGTGTTTTCAGCGTCGAGCTACTGCGGTTCTCAGACCAATAAGGGTGCCTACGTTCAGCTGGAGCTGGG
GGATGACAACGAAGTCAAGCCACATGTTGTGCAATTTTCGTCTCACCCGCTTCAGAAACTGAAAGATACCGGGAGGAATGGATGGCGAAAGAAAGCCCAG
CGTTTGGAGCGTCGGACAGTGATGTCACTCGTGGAAATCATCTGCGAAAAGAAGAACGCATTACTATCCGCTTTCAATGAATTGGACACTACAGGCTCTG
GATGCGTCACTAAACTCGAGTGGAAGGCAATCCTGCAAAAAACTTTGGGAATTGAAGTTAGATTTCTTTCGTATTTCCACCAGTTGGCTGAGGAAGACAA
GGATGGAAGTGTCGACTTCCAGAAATTTCTCAACCGGTACACCATCGAGTTGGATGGCGGCAACGTTGAGTGGAGGCGCAATCTGATTCGTAAGGTTTGG
ATGGGGTTTTGCCAGGCTTTGCCGCATCCTTCCAATACGGACACCGAAAAAATGACTTTGCACGACAAGTTGCACTTGGCGTTCAATCTTTTCCAGTCGT
CCTCTGAAAATGGCAAGAAAGAGCAAACAGTGAAGAGCGACGCAAATGGTCAATCTGGTGGTTCTCTCAACGGAGATAAAATGCCACCGAGGGAAAGCTA
CCTTCGCAACAATCTAGTCACGTACGAGGTGTTCCGCAGTACTATTCAAGGCAAGCTCGAGCTGGGTGATATCCTCTCGGAGCAGCAAATATTTGAGCTT
ATGCAGCACCTTGACCAAAACCACGATGGCGTGGTGGACTACCAGGAGTTCTGTTCATTCTTCGCTGAGTTTAGTCGTACTGATTACCTCCAAGAGCTCT
TTGAGGTCGACGACACTAAGGCCATTTCACTTCTGAATCGCTGCGCGACGCTTCTGCAAAATCCTAACAAGTTCAAGTCTCTGAGAGAGGCATTCGACTC
ATTTGATCACAGCAAAACTGGAAAGTTAACAGTAGAGGATATCTTCAAGGGAACGCAAGAGCTGAACATGGTGCCGGACCTAGATCAGGATGACGCGCAA
TTGCTGTTTAACTCGATTCTGCGCAGCTACTATGGCATTAACCAGCGCCACCAGTGGGAAACGCGGGGTCTGGATTGGGTGGTGTTCGAGGACACATTCT
CGCCGGACAGCACCTTCCAGAGGCGCCTTTGGCTAACGAGCCTGGACGCGTCGAGCACCAATTTGGCCGCAATGGATGCCCAGGACTCACTTTCTGGGGA
CGACGACAGCGTGAAGGAGGGTCAAACATCGACAAGCCAGACTTGGGCCGACACTTTCGTCGACAGCGTGAAACAATCACTACACGAGCAGCGGTTGTAT
ATTAAGTTTATCTTTCGGATACTAGACCGCAAGCGACACGGTTACGTCACCAAGGAGAAGTTCATCGCCACTATGCAAGCCATTAACGAAGAACATGGGT
CACCGTTGCAGCTGTCCCAGCTGGAACAGCTAGCTGACGCCTTCTCGCACCCCAAGGCAATTCGGCGCATGCCGGCGGAAGGCGGGGAAATGGAGGAGAC
GCACATGTTTGTGTCCTACCCAGAATTCCTCCGGAGTCTGCGCATCATCGACTCTGGGCCGTC