Description :
From Genome Similarity Track
Location :
Scaffold_44:57703- 58810
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09339Avr4-associated TDF-like protein

Sequence
1107 bases(100 bases per row)
CAACGACTTACTTGCCTGGGTGCAGACCGAGCTGGCCCGGCGACGGCTCGCCCGTGACTTCGCCAAAGTACAAGGCAAACGTGGCCTTGAGCTCCTCAAT
CTTGGCGCGGTCTTCCATCCACGTCTGGAACGCAACCGAGTTGGCGCGCTTGATGTCCCAGGGCTGCACGCCGCTGGCCGGCGGCACGTCCGTGCGCGAC
GAGAAGCCGGCCATGAGGCTCGACTGCACCTCCTTCGAGACGATCCAGTTGACAAAGAGCTTGGCCGCGGCCATGTGCGGCGCCTTCTTCAGAATCGCAA
TGCGCTGGCCCCACGCGAGGTAGTCGGACGACGCGTTGGCGCCCGTGATCTCCTTGATCGAGCTCGAGTTGGTCGCTGGCGCCGAGCCCGCGACGCCGAT
CGCCTTGCGCTGCGCCGTCACCGCGAGGTCGGGCGTGTGCGAGCCGCGCTTGAACTCGATCTGCTGCGCGGCGAGCTTCTTGACCCAGTCCCAGCCGTAC
GCCTTGACGTAGCGGTCGTAGATGAACAAGGTCGCGTCGTCGTCGTGCGGGTATGCGGACGCGATGAGACCGGCGTACTTGGGGTCGGCGAGGTCCTTGG
CCGTCGCGGGGGGCGAGAGTCCCTTCTTCTGCAGCAACGCCTCGTCGTAAAAGTAACTAAACGTAAAGACCGCGTGCGAGAGCCAGTTGCCGTCGGGGTC
CGTAAAGCCCTTGTAGACATTGCCAAAGCCGTTGGGCTTGTACGGCAGCAGCTTGCCCTGCTTCTTCCAGCGCGGGTAGTCGTTGAGCGTCTGGAGCGCA
ACGACGTCCGCGACAAGAGAGTTGGTCTCGAGCTGGTTGTCGATGCGCGCGTTGTGGTACTTGCTGTAGTCGACGACCATGGTGAGGTTCATCTTGGGGA
ACGCGGCGCGGAAGGCGTCGGCGACGTAGTCTTGCTGCTGCGCATGGTCACCGCCATGGTACACGACGAGGTTACCGCCTTCCTTGAGCGCTTCTTCGTA
CAGCGTCTTGATCGACTTGGTCTCTTCGCCGTTGCCCGACGGCGGCGCCTTGGTCTTGCGGTACGCGCTCGCGTCTTCGAGAAGGAAGAGGAGCGGGAGG
AGTGCAA