Description :
From Genome Similarity Track
Location :
Scaffold_1723:577- 2155
Transcript NameFunction/comments
Phymu_g13584hypothetical protein

Sequence
1578 bases(100 bases per row)
AGGAGAGTGTTGGATACCAGAACCATCGATCACCTTGCCGCACCACGCCACTCTCTTAGCAAATAGAGTACACTTCTTTGCGTTCAGCTCGAGGCGTCGA
GCGCGGAGCACGACGAAGAGTTCACGCAGCCTGCATAGGCAGTCCTCGACACTCTTGGCGAAAAGCAACAGGTAGTCAATCCATACTAGAAGGCTGTGGT
ATAGCATTTCTCGAAAACACTCCTGTATCTGAAGCTGGAAATGCATGGCCGAGTCACTGGCGCCCTGCGGCACCCTCGTCGGTGTGAATACGCCGTCCTC
CgtgacgaagctgaaaaGCTCTTGACTCTCAGGGTGTAACAGCAACTGCCAGAATCCCTTGAAGAGGTCGAATAGACCGAACCCACTAGCATCCTTCACG
CTCTGCGTCACTGCAGCCAGATTCGGGGTCGCACCAGCCAGAGGCACTGTGCACTTATTGGTAGGACGGTAGTCGATCGTGCAGCGGTAGTCGTCACTAT
GCGGCTTCTTCACTGGAAGCGCCGGACATGCCCAACGACTCGAATTGTTGCGGTGGACGAGACCGTTCCGCTCCAGTTCACGGACAAAGTCGCGTAAGTA
tgcacgctgcagctcaggGTACTTCCTAGTACCGCTACGGTACGGCTCCGCGCCACCACGCAGTCGCACCTTCAATggctcgacgtcgacggGCGGATCC
GCTCCAATGTTGATTTGCCACACATATGCAAACTCGAACACTAGAGATCGCAGCGCACCCAAAAGCGGTGACTCGAACCCCGCTTCTTTGGCCGCTTCCA
GCATTTTGTTTAGATATTCGTCAATCTGCTTCTTATCCACCGTAAAGGTCAATTGAGGGGTCTCGTTGGTGATGTCATCTTCCTCAGCATCACTGACACT
GTTGTCACCTGCTAACTGCTCAAACAATCGGTCTGTGTCAATGTCGATGTCCTGCATTGTCCTGCGGCCAAGCAAgaactcgtcttcgttcCCGTCCATG
ACGAGGCACGGGACACTGGCGAGATACAACGGACCAGCCGCTGTCTTGATCCGCAAGTCTAGAGTAGCGGAATCCCTACACATCATCTTAGCTCCACCTG
CAACCTGTACACGAACCGGCGGGTCCTGTGAGTGCAGCACAACGTCACTAATATCTTGAAGCTCGTCGATCAGAGCCCTCGAAATGATATTGCTATCGGC
ACCAGCGTCCGGACAAAAACGCATGTCCAAGACGCCGTTGATGCAGACACGGCGCCATTCACCAGCACGCACGCTCCGCACAGTCTTCGCGCATTCGTCG
CTGCGTGATTTTTGTTGCGAATGGCATGCtgcacctcctgcttctACTCCTCCGTAGCACTGGGGCAGTCTTTAGCCCAGTGCAAGCCTTTGCAGATAAG
GCCATCCCGTCcgaggtggagctgaaggcggcTTTGCTCCTTTTGTACGGACGTCTTTACCACCCGCTATAGTCGGCAGCTGTTGCCTGGCGCCCGACTT
GCCTTGCCAGTCTGGCCCCCAGACGGTTTGCCCTTTGGAGCTTCGCTCCGCTTCAACTCGGCTTGCATACTGTGATAG