Description :
From Genome Similarity Track
Location :
Scaffold_592:577- 2006
Sequence
1429 bases(100 bases per row)
GTAGCACCAGAGTCCAAGTACCATCGATCGTGAGCGAGGTCTGCAATCTGCCTTTTCAAGTTCATCACATGAAGAATTACGTAGGCCTCATCACCTGATT
CATTATAGGTCCCTTTTCCTGCTGTCTTGCTGCGCGTTGACGGCGGGGCATCGCTCTTCGTTTCGTTTGGCGGCCGTTTACCAAGATGAGGGCATTCGTA
CACTCGATGTCCCTTCTCCTTGCAGTGAAAGCACTCTGGACCACCACCTTGCCCGTACGAACCTCGTCCACCAGCGCCTCGGCCTCTGCCGTAACCTTCT
CCGCGGCCTCAACCACAACCTTCTCCACGACCGCGTCCAGCCCCACGACCGCGACCTCGGCCACCATCAGCAAATAGCGCCTTCTCTTCATTAATGTTAT
CGGCTGCCACCTTGCGGTCTTGGCGGCGGTCGTACGCAGGTTCAAGGGCGTGCTCCAACTGCTCATAGTTCGGGGGTTCGTTTGGGTCAGTCAGCACGTG
AGAGGCCAAGAACGTCTCCACCACATTGTCGTAGTCACTGGGAAGCGAGCCAATGAGTAGAGCCGGCTTCTCGTAGTCGTCCAGTGGCTTCCCAAGCAGC
CCGATCCTATCCATCAGGCGTCGGATCTCGCCGAGATGGTCCGACATATTACCCTTGGCGTCCAACTGCAGCTTCCTCAACTTTGTCATTTCCGCAGCAT
ACTTAAAGTAAGTCTTTCCGATGTACCGTTTTTCAAATGTTCCATCACTCTGTACGGGGTTGCCTCGTACTTGACTGTCTTCATTATCTTGTCAGTCATA
CCATCGTACAGGATCTCTTTTGCTCTCCTACTCTCCTTCATGTACTTAGCATGATCATCCGTCTCCTCTCCTTTCGACTCGTCATCAGGATTGTGGTATG
CGCTGCTGAATTACTATCCCCAGGATGTGGATGATGCGTCCATCTCAAACCAGGAGTCTACATTGGGGTATTGTCGTAAGACAGTGCACCGAGGTCACTA
AGAAAGGGTGTACTGCCCCAGGCTGGTTTACAGAGCAGGGAAAAGCCTTCGCTCTTGGTAGTGGGAGGATCTCGTATCAGAATCCTGATGTACTACTACT
GCGCTGAAAATTGTAATTCGAGCACCTTGCGAAAACTTTTCAGTGAAACTTGGTTCCGTGGGCTCTTTTTCGCAGTAGCTCCACAGGCCTTTGCGTTGGA
GCTTCAAAGTCATTCGCTACAGCCACACTTCGAAGTCCTGGCCATCAAAAGATGGGTGTGCCTTCTTCTTGTCATCCGATCCGCCCTTCTTGGTGTTGTT
TGTGGTGCTCATCTTTCTTGTTACAAGTGACCCGTTGGGCTCATAACCACTTGTAAACTGCACTAGTAAGCAAGCGTCTGCACCTGCAGCAAGAAACGTA
GAGCACTCGAAGTTGGTGGGAAAGGCAGC