Description :
From Genome Similarity Track
Location :
Scaffold_249:57672- 61391
Sequence
3719 bases(100 bases per row)
AATTGAACAACTTCCTCTTCCAATTCCGCATAATTTGGTATTTGATCAGGGAATTGCTGGATTGACTTCCTTTTTACTCAGATTTCCTTCCTTTTCTATA
AGTAAAAACCCAAACCATCTGAATTTGACTGATTAAAAATTATCGTGTGAAACGTATCGAATTTAGTATCCTATCCATCATGGTACCATCTAGCTAGTCT
AAGGGTTACAGTGCGGTACTGTATCCACCTTTCGATCATACCTGGGGTGTTGTCCGTCCATATTACTATCTGCCACTTCTTGTATTACGACTCCTACATT
GAATACGATCCATTATAATAAACTCGTAATCTACCGCAAATCATGTCAAACCACGTCAAGAAAGGACGCAGCTAAAATTTGATGCGAGCGTGACAACACC
ACGGAGCTCAATCTCTGCGCACGGTAAAATCTCTGCGCACGGTAGGCACGATGATTGAAAGAATACGCATGACGATCATGCGCGGAAACCGTGTGCATTG
ATACGAGAATTGTTTACGCTATTTTCATTTAGCTACTTAAGAACGACGCTAAGCAAATAAATAGCAAATTAAGGTATCTTATGATGTTATTTTTAATTCT
TCGTGTCGCCTTCTTCGTCTTGTAAACTCTTTTTTGGTACTGCTAACTATTAAAAGTTATGAGTTATAGGGTATTTCTTCTTCATCGCCATCACCACTCT
TCCTATCGTTGTCTTCTTCATTTCCCCTCCTTTCGTCTATATTTTTTTCTGTTGTTATTCAAATTATTGTCCGTTTAATGCGATTAAAGCTGCATATGTC
CACCCTAAGCTTTTTAAACGTAATGGCGTAGCTAATCTGTTAAATGGAGAAGTGTGGCCATAAATCTAATTTGTAGAGAAAGCCAAAATATTATATGATC
GCTTGATATTAGACGCTTTTTGTGCTAAGTACTCGCAATTGTCGTCTAAAGCTTTACGCAAGTATCATAACCGGTGTCATCGGCATTTATCACAATCGGC
ATTGCCATATATCTCACATTCAAAAAACCTGGCGCTATAACAATGAGCGATATCTGTTAAATAACTTAAGGAAAATGATGGTGTATACTGGCCTGTCGCT
TTCTCGAATCTTATGGTGAAGTCTGGCGAAGGTAATTGCGGGAGGTGTAGAAAGATGTATCAGATCCTCTACGGATACTAGATATGTTTATGTTATGCTG
TTCTCAAGCGAGGTCACAGTGCTCACGCAATATTCAGTTCTATCTTGGCTATTACAATATGCTGACCTCAACGCTAGATTGAGAAGTTTAGCTGCACTAC
TATCGAAGAGAACACTGTGGATTCGCCAATTTATAAAGATAGGATGGTTCAAAGGTGTTCTTCGCATAGGACTATCTAGCTATTGACTCATTACCTACTT
TTCTTTACCCGCTTGAGTCGTCGGCAGCTCAAGTGCTAAGCACCGCGATGACTGCCTTGCATCAGCTGAACTTTAATTGCTGGTTATAATACAGGTATTG
TAAAAATTGACCAGTTGATCGGCCAACTCACTTAGCAAAATGCCGAGGATGAGCCCGTTAAACCACTGTTTAAAGAGTTACTGCCAGTTACATCCTGCAA
CCTAAAGAGGAGACGGTTGCTATGTGCAACGGTGAAAGTCATTACCTCCTCGTTGCAAGGCGAACTATAGGATTTGGTGTCCGCCGAACCCGAACTTGCT
GTGGCTGCCCCATTTGAAAAATATTCTGTCATGGGAATACCATTAATCCTTATTCAGATGAAGACTTATAGACTCGTACGGTCTCTTAGACTATTCAACT
AAGCGGGTATTAACTTAAAAGGTCTCTAGTCTCCGCAGACTTATTGAGACTTACCTCTAATAATCGAAACAAGCTTTCGAGCACCTAGTTCTGGTCCAGG
AGACTAACGACTCCAAGGAAATGACGCGGCACTAATGCTCAAGATTACTAGCCTTAGTACAGGCTACTGACTCCTACGACCAAAGACGTCTTAGCAAGAC
AAATGTCTTAGATTGATAAAAAGGGGAGCTGAATTTATTTACTGATTTATAGCTATAATAAAACTCACTTGCGTATTTAACCTTGAAACTATGCTACCTA
ATCGAGTAGTCCTACTGAGGGTTCTTCTGGTGTTACCACACCAGAACTACGCCGTGCTATGAAGACCCTATTACGATGGATACCATCTATCCGTAATCGA
TAAGGTACGGTATTACAGCTAGCGTATGTGATACAATACTACGCCTATCAGTCTTATTGATATCTTTATTTGTGTATCACACCTGCGTACCTGGTTATCA
CAACCGTTAGTGTAACCCTGATACACCATCCCCCACCAAACAGTCGATACCTTGACTCGACATTCTTCACCTTTCTCATTGAGTAGCTTGGAGAGAGTGT
ATGACCTAACGTTTGTGTTGACGTCACATTGCGCATCAATGGTGAAGTCCTCGCATTCCTCCGAGTCTTTGGAAGCCATTCTGCAAGAAGAGAACATCGC
CGATTATGACAGCGACACTGGCGCATCAGAAGGTGAAGATCCCGAGCCTGAAATGTCAGCATCGCGCGACCCCTCGTGCATAGTGCCGTATCTCTTTCCT
GCGCGAAGTACACTCAAGAGCTAAGAGCGCTGCGTGCTTCAACTAGTCTTGATGAACCGATCATCAATAACAAGCTCGATGAGCAACAACAGCAGCATAT
CGAAGAGAATGAGAGGTCTAGATGTCTATTCCACACATTAGCTATTACCGAGGCGCGTTCGTACTACAAATTCAAGCATTTGGTAGTTAATGAGTTGTTA
CGAAAGTTCTCGGGGTAGCCTTTCACCACTTTGCCCAAAGGGCGCGAGGCTACGACTTCTGACGACATTGCCGAAAGAAATGCTCTCAGATAGAGATACC
CAAATGTGAGAAGTGTCGTCTATCAACTATTACCAGGCAAGGTTGGCGGAACAAGCACGAGGTGCCTCTGTACCCACGCAGATAACAATCCCGATTTTTC
TATACCTGGGCGATAGTGAGGCTGAAGATGACAGCACGTACACTCGCTGGGATCATAGAGCACGTCGATTGCCCAGTATGAATGTCCTTCGAGCTAGTGC
CTCCAAGGCCGACGTTTAGTTAAAGCGCAAACTGCGTTATGAATTTGCTAAGTTGACAACTAAAGGCCAACTACGATCACTGCATCGTAATCGATACGCA
AAACTAGCTGCTGGTCAAACCTCCACTATTTCGACTGGCAGATAGTCGCAGGTCACTCGGTGTTGTTGAGCGAACCGTACACCCCCACAGCTATTGGTGA
AGCGAGTTGAGACGCAAGCTGACACTCAGCGCGACGATCAAAAATATCGACGGCGTACGGACAATATTGCCAAAGGGGCACCTCAAATTCCCGTGAGTTA
TCAGACTCAGGGTATTCAAGCCACCAACCAGATACTGGTATTGACCTCTGTGGCGATGCCACTTCAAAAGACTCTTCACATAGAACTGCAACTTCCCTTG
CTCGTCGAGCAACACAGAAGAAGGAGTTCGGCATATCAGTGCAGGCTTGGGTGACTTGGTGTCCGAGGTGACGTGCATCTGCGAGTCTCTCGATCACATG
CAGAATGCACTTGATCAGTCGGAGACTGATTGGAAACAACTCTGGGAGATTCTCGATTAAGCGCAGCGCGCTCGTGAACAGTCATCGACTGAGTTGACTC
AGTTGCGTGAGCAGATGAA