Description :
From Genome Similarity Track
Location :
Scaffold_509:5767- 7244
Sequence
1477 bases(100 bases per row)
GGACATGCTGGAGTTCAATCTCCACATCCTCTTTCTCGTTCGCGACCTGTCGGCGACTGGCGTCCAGGTCCCCATTCTGCTTGATAAGGTCCGAGATGCG
CGTCTGCGCGGTTTTGAGCTGCCGCATCAGGTCTCCATTGAGTTTCTTCGTGTCTTGAAGCTCAGCTCGGAGCATATCTTCTTGTTCCAGGTACGACGCA
GATTTGGCTGCGCTCTCGAGCTGCCCCATGAGCACGCGCTCACGAGTCTCGAGCGCTTCAATGCGGGACTTGAGCCGATTCACCTCTAATGACTGGCCAC
CGTCGCCCGATGAGCGCTTGAGATTCGTCAGCAGCGGTAGCTGCGCCTCTTTCTCCTCGAGCTCCTTCTCAAGTTCCTTGCGGCGATCCTGTTCGAGCTT
CATCTCCTCTTCAAGCGCATCGAGCCGCTTGCGGAACGCTTCCCACTTCGTGTTGCGCACAGTCAGGTCGCGCTCCTTGACCTGGGAGATCGTGGTCTCG
AGCACAGCGACCTGGTTGCGAGACTTGTCGCGCAAGTCGCTCAACAGTTTAGAACGGTTCTCCAACTCGAGCTCGAGCTGCTGCGCCTTGATCGTCGCGT
GCTGCTGGTCTTCAGATAGAAGGTCGTACTTGAGCAAAAATTGCTGGTAGTTGGCCTTAAGCTGCATGAGCTGGTGCTGAAGCTGGCCCACCACCGCATG
GTCCTCCGAGAAGGCCATGAGATCCCGCAGCTGCTCGTCCTGGGCTTCGTGCTTGGATTTTTCCTGGGTGGCGCGCTTCGCCAGTGTGTTTGCCTGGTTT
GCTGCAAGCGCTGCGATATCCTTGTACTTGGCACACTCGCGCGTGAGGCTCTCGTAGAGCTGTTCGACCTCGCTGATCCGCTCAAACAGCAGCCCGTTCT
CCTTTTCCAGGTCGCTCTCGTACAATTCCAGCTTCCTGGCTTCAGACTCACGACTGTCAGCCCTAGCTACGCCAGCATGCACCGACACTAGCCCCACAAG
AGACGCAGCGCCGCTACTACCATCACCAGCAACTGTGATTCGGGACGCTTGAATTTCTTCGAAATCCTTCACGCGCTGCGTCTGCACCGCAAGCTCATGT
TCAAGCTGGCTGATACGCGCCTGAAGCGCCGGATCGATCGAGACCTTGTCACCACCGGGCGCTTTCTGACCAGAACCACCATTGCCTGCACGCTTCTCTG
CTATCAACACTGCATTCTCATGTTGCACGCGACTCAGCTGACTCGGGAGGTCGTACATCTGAACAAACTTGACGTGCATCTCCGAGTACGCTTCACTAAG
CGCGTTGTACTTGTGCAGCACCTGAACCATCGCCTGCTCCTGCCGTTCCGCAAAGGTCTTGAGCACACTCTTCTCCAGCGTTCTCTCCATGCGCTCAATG
AGCTCGTCGGCGCCCTCTTTCCAGCTCTCGAGGTACAATATCCGGTACTTGAGAGTCTTTTCCATGTCGAGCCAGTC