Description :
From Genome Similarity Track
Location :
Scaffold_249:57666- 61412
Sequence
3746 bases(100 bases per row)
AAATTAAATTGAACAACTTCCTCTTCCAATTCCGCATAATTTGGTATTTGATCAGGGAATTGCTGGATTGACTTCCTTTTTACTCAGATTTCCTTCCTTT
TCTATAAGTAAAAACCCAAACCATCTGAATTTGACTGATTAAAAATTATCGTGTGAAACGTATCGAATTTAGTATCCTATCCATCATGGTACCATCTAGC
TAGTCTAAGGGTTACAGTGCGGTACTGTATCCACCTTTCGATCATACCTGGGGTGTTGTCCGTCCATATTACTATCTGCCACTTCTTGTATTACGACTCC
TACATTGAATACGATCCATTATAATAAACTCGTAATCTACCGCAAATCATGTCAAACCACGTCAAGAAAGGACGCAGCTAAAATTTGATGCGAGCGTGAC
AACACCACGGAGCTCAATCTCTGCGCACGGTAAAATCTCTGCGCACGGTAGGCACGATGATTGAAAGAATACGCATGACGATCATGCGCGGAAACCGTGT
GCATTGATACGAGAATTGTTTACGCTATTTTCATTTAGCTACTTAAGAACGACGCTAAGCAAATAAATAGCAAATTAAGGTATCTTATGATGTTATTTTT
AATTCTTCGTGTCGCCTTCTTCGTCTTGTAAACTCTTTTTTGGTACTGCTAACTATTAAAAGTTATGAGTTATAGGGTATTTCTTCTTCATCGCCATCAC
CACTCTTCCTATCGTTGTCTTCTTCATTTCCCCTCCTTTCGTCTATATTTTTTTCTGTTGTTATTCAAATTATTGTCCGTTTAATGCGATTAAAGCTGCA
TATGTCCACCCTAAGCTTTTTAAACGTAATGGCGTAGCTAATCTGTTAAATGGAGAAGTGTGGCCATAAATCTAATTTGTAGAGAAAGCCAAAATATTAT
ATGATCGCTTGATATTAGACGCTTTTTGTGCTAAGTACTCGCAATTGTCGTCTAAAGCTTTACGCAAGTATCATAACCGGTGTCATCGGCATTTATCACA
ATCGGCATTGCCATATATCTCACATTCAAAAAACCTGGCGCTATAACAATGAGCGATATCTGTTAAATAACTTAAGGAAAATGATGGTGTATACTGGCCT
GTCGCTTTCTCGAATCTTATGGTGAAGTCTGGCGAAGGTAATTGCGGGAGGTGTAGAAAGATGTATCAGATCCTCTACGGATACTAGATATGTTTATGTT
ATGCTGTTCTCAAGCGAGGTCACAGTGCTCACGCAATATTCAGTTCTATCTTGGCTATTACAATATGCTGACCTCAACGCTAGATTGAGAAGTTTAGCTG
CACTACTATCGAAGAGAACACTGTGGATTCGCCAATTTATAAAGATAGGATGGTTCAAAGGTGTTCTTCGCATAGGACTATCTAGCTATTGACTCATTAC
CTACTTTTCTTTACCCGCTTGAGTCGTCGGCAGCTCAAGTGCTAAGCACCGCGATGACTGCCTTGCATCAGCTGAACTTTAATTGCTGGTTATAATACAG
GTATTGTAAAAATTGACCAGTTGATCGGCCAACTCACTTAGCAAAATGCCGAGGATGAGCCCGTTAAACCACTGTTTAAAGAGTTACTGCCAGTTACATC
CTGCAACCTAAAGAGGAGACGGTTGCTATGTGCAACGGTGAAAGTCATTACCTCCTCGTTGCAAGGCGAACTATAGGATTTGGTGTCCGCCGAACCCGAA
CTTGCTGTGGCTGCCCCATTTGAAAAATATTCTGTCATGGGAATACCATTAATCCTTATTCAGATGAAGACTTATAGACTCGTACGGTCTCTTAGACTAT
TCAACTAAGCGGGTATTAACTTAAAAGGTCTCTAGTCTCCGCAGACTTATTGAGACTTACCTCTAATAATCGAAACAAGCTTTCGAGCACCTAGTTCTGG
TCCAGGAGACTAACGACTCCAAGGAAATGACGCGGCACTAATGCTCAAGATTACTAGCCTTAGTACAGGCTACTGACTCCTACGACCAAAGACGTCTTAG
CAAGACAAATGTCTTAGATTGATAAAAAGGGGAGCTGAATTTATTTACTGATTTATAGCTATAATAAAACTCACTTGCGTATTTAACCTTGAAACTATGC
TACCTAATCGAGTAGTCCTACTGAGGGTTCTTCTGGTGTTACCACACCAGAACTACGCCGTGCTATGAAGACCCTATTACGATGGATACCATCTATCCGT
AATCGATAAGGTACGGTATTACAGCTAGCGTATGTGATACAATACTACGCCTATCAGTCTTATTGATATCTTTATTTGTGTATCACACCTGCGTACCTGG
TTATCACAACCGTTAGTGTAACCCTGATACACCATCCCCCACCAAACAGTCGATACCTTGACTCGACATTCTTCACCTTTCTCATTGAGTAGCTTGGAGA
GAGTGTATGACCTAACGTTTGTGTTGACGTCACATTGCGCATCAATGGTGAAGTCCTCGCATTCCTCCGAGTCTTTGGAAGCCATTCTGCAAGAAGAGAA
CATCGCCGATTATGACAGCGACACTGGCGCATCAGAAGGTGAAGATCCCGAGCCTGAAATGTCAGCATCGCGCGACCCCTCGTGCATAGTGCCGTATCTC
TTTCCTGCGCGAAGTACACTCAAGAGCTAAGAGCGCTGCGTGCTTCAACTAGTCTTGATGAACCGATCATCAATAACAAGCTCGATGAGCAACAACAGCA
GCATATCGAAGAGAATGAGAGGTCTAGATGTCTATTCCACACATTAGCTATTACCGAGGCGCGTTCGTACTACAAATTCAAGCATTTGGTAGTTAATGAG
TTGTTACGAAAGTTCTCGGGGTAGCCTTTCACCACTTTGCCCAAAGGGCGCGAGGCTACGACTTCTGACGACATTGCCGAAAGAAATGCTCTCAGATAGA
GATACCCAAATGTGAGAAGTGTCGTCTATCAACTATTACCAGGCAAGGTTGGCGGAACAAGCACGAGGTGCCTCTGTACCCACGCAGATAACAATCCCGA
TTTTTCTATACCTGGGCGATAGTGAGGCTGAAGATGACAGCACGTACACTCGCTGGGATCATAGAGCACGTCGATTGCCCAGTATGAATGTCCTTCGAGC
TAGTGCCTCCAAGGCCGACGTTTAGTTAAAGCGCAAACTGCGTTATGAATTTGCTAAGTTGACAACTAAAGGCCAACTACGATCACTGCATCGTAATCGA
TACGCAAAACTAGCTGCTGGTCAAACCTCCACTATTTCGACTGGCAGATAGTCGCAGGTCACTCGGTGTTGTTGAGCGAACCGTACACCCCCACAGCTAT
TGGTGAAGCGAGTTGAGACGCAAGCTGACACTCAGCGCGACGATCAAAAATATCGACGGCGTACGGACAATATTGCCAAAGGGGCACCTCAAATTCCCGT
GAGTTATCAGACTCAGGGTATTCAAGCCACCAACCAGATACTGGTATTGACCTCTGTGGCGATGCCACTTCAAAAGACTCTTCACATAGAACTGCAACTT
CCCTTGCTCGTCGAGCAACACAGAAGAAGGAGTTCGGCATATCAGTGCAGGCTTGGGTGACTTGGTGTCCGAGGTGACGTGCATCTGCGAGTCTCTCGAT
CACATGCAGAATGCACTTGATCAGTCGGAGACTGATTGGAAACAACTCTGGGAGATTCTCGATTAAGCGCAGCGCGCTCGTGAACAGTCATCGACTGAGT
TGACTCAGTTGCGTGAGCAGATGAACCGTCTCGGCTCGGTCGACAC