Description :
From Genome Similarity Track
Location :
Scaffold_98:57660- 64057
Transcript NameFunction/comments
Phyta_totarag3535hypothetical protein
Phyta_totarag3536conserved hypothetical protein

Sequence
6397 bases(100 bases per row)
GATCCGACAGAAGAcagaggagctggacgaacttcaacgtcgagtCCTGAGACTTTCCAAGACGCTGCATGATTCGTCAGAAGAAAAAGCTTTTGCCAAG
ACGAAATTGGTCAATCAGGAAGAGATCcgcaaacagcagctgcatgcCAAGTCGTGTCGGCATTGTGGGCGCGATTATCTACCTGGGATGCTGATAGCAC
ATGAAGAGAATTGCATGGACAAATCGCTTCCGAGACTGCAGCCAATTGTTGGAGCGAACCAAGTTGCAGACAGTTTGGAGCTTCGGAATTCGAGATCACT
TCCGGCGATTCACAAATCTTCTGCAATACCGGACGCACCACTAGCGACACGATTTGTGTCACAACCACCGCGTAATCTTCGTGTGGATTTAAAAGCGGTT
GCACATAATGCGCTGACGATTAGGTGGGATCCTCCGATTTTTACCGGGTCGAATGTCATTTTCGACTATGAATTGAAGTACTCGATTTGTCATTCGAGAA
TAAAACACGACGAGATACAAAGGCAGTTCGATCCTCAACCGCCTGTACGATTGTCCCAGTGGTGTCTGTTGAATCCAGTTCCTGGAAATCAGTACCGGTT
GTCAAGCTTATCTGCAGACCAAGAGTACGGCGAGTTTTCAATCTGTGCAATTACTGTCGCCGGCAAAAGTGCCCCAAGTAACAAAGTGGATCTTGTTCGA
ACAGAGCCTGCTGTGCCCCCTACGATACCTTTGTTTCTATGCGTCGGAGTTGTTACGGCAACAAGTATCACGCTCACATGGATGGAGCCTCTGGATGACG
GCGGAAAGCCGATTCAGGACTATGAAATAATTTTTCTCGAAGCCACGATTAAGATAGATAATATGGACGATAAGGGAAAAGCCCGGCTTGACGTGTCGGA
AATCGAGTACAAGAACCGTCGAATAAGGACTAACTCGACGGGAACTACACTGACGATTACGAATTTATTGAGTGGGGTAGTGCACCTTAACTTTCAGGTT
CGAGCTGTGAATGCTGACGGAATACCGGGTGACTATTGTGGATTAATCAAGTCCATATTCACTATAGGTAAGGAATTTAGACTTTCGAATTCTTTATCTC
ACGCACTGACTCGTTGATTTGACCTGAACAGCTCCAGGGAACGAATTcaagcttcttgatgaaTTGCAGGCTGCTGTAAATTCGCGCTCACGCACGGTGG
ACTCGCAATTTTTGAGCGGCTTTATGCAGCGGTACGAAATACACCACTACATTGAGCAAGTGTCTCGGTTTATCCTCTCAATGCACCCGGAGCTACAAGC
TAAGGTAAACGATATAGTAAACCGAATAGACCCCCGCATaagagaaggtggagagATGGACGATCAAGAACAGCAACCTCAGACCATTCAGCAAGCCAGT
GGCCGAAAGAAGTTCGACGATCTTACGGATGAAGAAAAAGTGGCTGAGCGTCGACGGCAATTCCACTTTCGCATTGCTGAGATTCGTAATGATCTGAAGA
AAGCTGAGTACAACGTCCAGTGGTGCAAGGAACGCCAAATTGACTTAGTCGCACTAATTCGAACGGCAGAATCTCGCATTCTTGAGAAGCAGGCTGAGCT
GGAGCGTGCTAGAATGTTTAAGGGACCGCAAATGGACTCGGATGTCTTCGAAAATGGACTTCAGCGGTTCTTCACGAAAGAGCTCGTAGTAGTTCTGGAA
GATGAAATTGAGATCGATCAGCTCTACATTTTAGATTCCAAAACTGAGATTATAAAAATGGAGAACTACCTACGCGCTGACATTAAACGACGAGACACGC
TATCGAAGAGATTAAAGGAGAGGCAAGAAGCACTAGAAATATTTGAAAGCAACCCCGAAAATCCGGCGGACTCTACCAGCACGGCAGCCACCTTGGCAAG
ACTGCGCGGTGGGCTGCTTTACCGAGCATTCGCTGCTTTTGTCGCAAACAGACAGGAGGCATACGAAATGCGAAGGAAAATGCGCACCGCGGTCGATCGC
CTCATTAACCACCGACTTAAGAGTGCAGTTCAGCGATGGAGAGAGGTTGCTAAATTCTTAACTCGAGCAAATGCTGGAGTTGATAAGATTTATGGAATTG
GTAGTATCGGCCTCTTGAATGCCGCACTGGGCCGCGACGATCTCATGATTGAGGCACAGCAACTACTACACCAACTTCGGTCAACTGAAGGCTCTCTACA
AGATATTCGTTGgacgacggagcagcaactAGCCTCGAAACCCGAAAGCCCGGCGTTGGACAGGGACAGCACTAATGAGCGACAAAATGCTCAAGAACGA
GACAAGAAATATTTTCCGCTTTTACTGGAAGGTGACACGAGGATGAATCTGCAAGACTATGAAGGAGCCCTTCGCCTGTACAACAGCGTGTTTAGCAATG
AGCAATGGATGCAGCAGATGGACGAGAGACAACGAGTGAAACTGCAGTTGAAGATTGGCGAATCCACATTCCGTCTCGAGTACTATGAGCAGGCACTGAC
GATATTCAACCGCGCATCAATTTTGGCAAACCGAGCTGGGCTGCGCTACGAAGAAGGATCAGCAGTGCTTCGCATTGGAGATACACAGCACGTACTGCGA
TCTCTTCGAATGAGTATTGAGAGTTATGAGCGTgctttgttgttgtttgaAGCTGTTCGGGATGTGCAAGGCGAGCTATCGTGCTATCGTGGGTTGCAGC
ACGTGTACGAGAGACTCGAAGACAGAGAGATGATCGAAATCAACAGGCACCACGCGGACGAGATCGAATTCGTCTTGACAAAGAAACTATCGTCAGCTGG
ACAGAAGATAAAcaagcttcagcaacgaTTGGTGGGTGCTGGCGCAGAATCCTCTTGCCAAATCACCCTTGAGCGAGTGGGTCCCATTGTTCCGAGAATA
CGAAGGGAGCGAATTCAGCGCAAGGTTGATATTCGCGAGGAGATCAAACTCGTTGCAAAACTAGAGAAACTGCTGTCTGAAAAAAAAGAGTTGCTGGCAA
GAGGCGAAGATGATCTGAAGCGAGCACTCGCCAGCGATTCGTCTCAAGTCGACTCGACAATCATTAACGGTTATAATGCGCGCTATGATCTCGAGGATTT
TCAGAAGAAGCTTGCTAAACTCATGGGTAGCGTCAAAGCTGGTGAGGAGCAGATCGGCAAAGAGATCATAAACGCCAAAATCCGCATCAGCAATGCCGAG
GATGAAATCAAAGGTCTCGAAGAGGAATTGGCTGTGGAGACGGGGATACTCATGCGCAAAGTTCTATCCAAAGAGAAATTACGGTGTTTTTGCTTCAACG
CGACAAACGAAGCGTTGAAAAATGTGGTAGGAACCACGACCCACGGAATCACAACCTGCTTTGCGACTGCAGGGATGAATGGTTTTCTGTTTGACTTTCT
GTCTGGTGCATGCTTGGCCCAGGCTGTAGGCGACCCAAACAAGAATCATCTTGGCGAGCCTACAGGCCATCAAGCTCAAGTACTCTGCGTGTACTACATC
GGTCACCGTATTTACACCGGATCTGTCGGTGCTTCACTGGGTGTTTGGGATGTGAAGAATGAGACGATCGGTGGTTTCTCGTGCTCTCTGACACGTATGC
TCACAGactttgatgctgctgtggttAGTGTGGTAGCCGACACGCAATGGATTGCTTGCGGGTGCTCAGACTGCGATGTCTTCGTGTTCGATGTCGAGTC
ACTGGCAACAATCGCTCATATCATCTCAGCACACGACCGCACCGTGACAACTTTGTCCATACAAAGTGCCAACTCAGCACTCACAACGGGAGCTGCTGAT
AATAAAATCAAAGTGTGGGGGTTTGGTGAGGCTTCACAGTACACTACACGCCGAAAAGTAAAACTTGTATGTTGTCTCGAAGCAGAACGCCGCGGTGACG
AGTTCCTCAACGGTCATCTCGTCCCTGTTACCTGTGTCAGACGCGTAGCGAACGAAATTGTAAGTGGAGACAGCGCAGGCCGGATCGTGATTTGGAACTT
GGACGCAGACAGCAAGTTACTTCGGATCTGCGATGTGCACCGAGACGTAGCAGTGACATGCCTTCAGTTTGACGCTACGCGCATTGTGAGCGGAGCGAGC
AGCGGGCAGATTTGTGTGATCGATTTTGCCACTGGAAACCTAATTCAGACGTTGCACGGTCACCAGGGTAgtgtgctggatctgcagTTTGATCGCACAC
GGTTAATGAGCATGTCAGCTGATGGCAAATTGCACCTGTGGTTCTGGCAAACTCGAGATGGCGTAGGGGCTGACCGAAAGAAGTACCATATTCTGGGAGC
GGGCGAGACACTTCGCTCGCTGTCTCTCATGTACCGCACGAGCATCCAGAAGCTCCTCCAGTGGAACTCCATTCCCGATTCGACCAAGACTTATCTAGGT
CAGAAGCTCATAGTGGAAGTCGATGCAAACGCCAGCGCTTCAGATGAACTGAAGTCGCTGGACTTCTCGAGTTCGGTGCAATTTGGTAAACTCTCCTACG
AAAACCTTGACTTCGTTGCTTCCAACAAGACAAAAAGCAAAGACGTCGAAGCGCAATGGgctgcgcagcgcctcgCAATGCTCGCAAAGGAATATTTTCC
CTCcatgaacgacgacgacagcaacgacgccaAAGCGAAGACAAatgtagctgctgctgaagaagaggatgaaTCAGACTCCGATTCCGACATGGCCATG
GACTCCATTGCAGAGCAAAACGACGGtgatgcagacgacgaagaggagtAACATCGTAAAACTCAACCAAAAACTGCGCAaagtagtacatgtacattgt
CTCCGACACAGTGCAACACACGCTGCTTGAAATGCAGAGGTGGAGCAAAAGGATACAGCAGGAACATGGTGAAATCCTTCTGAGTTTACTCAAACCAAGT
TCTCGGTAGTCTCCATGCCCCATGATGCCTTGTCCTCGAGATACATGTTGCAGCTTCGGAACGCTGCACGTGCATTGTCTCCCGCAAAATATTCCCAGGC
GGAGTAGAACCAAAAGGCGACACACTTGCGGTAGTCGTTGGGCTGGGtggatttcttcatctggagGATACTGTGCCACTCCTCGATCACGAAACTCGAG
AGCGTGTCCTCAAAACGCGAGAGACGCAGCGGGTTGCGCACCGAGTACATCGTAGTCCAGTACTTGTTGTAGCCCTCCAGATGCTTCAAACCATCCAGGA
ACTCGGGTGCCCGGAACTCCTCGATCGAGTAGTCCAGCATGAACGCAAACTTGTCGCTGTacttggcctcctcctcgtaAAACTTTTTCCACGTCTGCAC
AAGGTAAACAGGCCCACAAAAGTAAGCTTCAGTTCCTTCAACACtaataaaaaaataattCCACGTACCACCGCGAAAAATTGCAGCGCTTCGTTTGGGT
CGTTCATCTTGGTGCGGTGCATGCTGTGTGCGTGACGCAGCTTGACTGTTTTCTTGCGTTCCCAGTGCCACTCCTCAATCGGAGGGAAGATCGACATCGG
CACCATGACCGACCCGTTGCCACAGATTGCAACGTAGAACGAAATGACGTCTTCCACGCCGaccgccttctccgcctGCTTGTCCCCCGTCCTGGAgacc
tcgtcctcctcttcgtccaaATTCTCGTTCGGATCAGGCTTGACGAAATCTAATCTAGTGACAAAGTACAAGAACTTGGTAGGGAACGGCTTCTGGCCGA
AGAACTCGCGCAGCTGGTCCCGCAACGTCGTCATGTCCTTCAGGTACAAAGTCTTCACCTCCTCAGTCGTGTAGAAACCATCTacacacagcaacaacaa
cagtaACATAATAAACAATTAATAATAAAATACCCATCAAACCTTCCAATTGAATTCCATGAAATCGACCGGCGTACTGTTTTCCGGACACTCCAGAGTA
TGTGACGCCGTCGTGTCAACCGTCGCCGGGTAGTTGAATCCACCTGTCAACATAGACAATAATTGTCACTCTCACGAACAACAGCACCAATAGCCGCAAT
AGGCCAAGTTCACGTACTGACGCCTTCACGCAGCACGTCCTTGTGCGTGACGCGCAGTGCGTCTTTGAGCTCGTCGTagttggtgttgttgctacaAAAC
TTGTTGTAGCCCACCCAGTACTGTGCGTACGTCTCGTTAAACACCAGGTGGCCGCGCTGGATGGTGCTGGCGCACACGAGGCGCGACGGGTCCGTGgcgc
gcagtcgctccacgttcttcttccagtcaCGGATCTGGCCCGTCTTCACGCCGTATTTCTGCGCCGTGGCGGCGATGAGCCCCGTGCGGTCCGCCTCCTC
GATGATCTCGAGCTTCTTACCCACCGTCATCGCCCGGTCCGCCTTCCCGCGCGCCATCACGTATGTACGTACGTCGAAGCGGCTACCGTAGCTGGTC