Description :
From Genome Similarity Track
Location :
Scaffold_1362:5766- 10593
Transcript NameFunction/comments
Phyta_totarag12795pol protein

Sequence
4827 bases(100 bases per row)
GCATCTGCGGCGCCAAGGGAAGCTCCCAAACCGAAACCGCTCATGGTGAGCGTCAAGGTCTTCGAAGGGAAGGAAGGGGAGAATTTCCTAGTATGGACCC
GTGAGGTCGAAATGGCTATGAATTCAGCCATGCTCCGAACTGAGCAGCAACGCGTGGCGCTGGTCATATCTAAGCTCGGCGGAAGAGCACGAGAGTGGGC
ACGCACGTGCGGAGCGGCTGTCAATACCGCTTTCCCAACCTGGGATGAGCTGAAGAGTCAGCTGGCGAGAGTCTTCTCTCCGCCCAATCACGCGTACCGC
GTGCGCTCtcgcttcttggcctgcCTCAAGGCAAaaaggagctggtggacttCGTCCAAGAGATATCTACGATCATTGCTGGCATGTTTGCCGACTCCCT
GCCTGAGGTAGTCACTGCAACAGTGTTTATGGAAGGTCTCCAGACAGGGGTGGCTCGAACGGAAGTCTTCCGAGTCCACCCCTTCTTCATTCAAAGATGT
CGTTGCGGTGGCATTGAATGCCGagcacaacttcaagttggtccGACTTGGTTGGAGTGCACCCCACTCAAACCCTTCGGGTGGTCCGGAACCCATGGAT
CTCAGCTAcgctgaagacgaggaagctgAGCTTCTAGCTGCCGAGCAGCGTATGCACATCCGGCGATGCTTCACTTGTGGCAGTACTCGCCACTTACGCA
TGGGATGTCCCCTGCGAAAGCAGCGCCAGGCTCCACAGACCCGAAGCTCCGCTTCTTACCAGGGTTCTGGTTCGTCGCGGGGAAACGGTGAATCCCAGTA
GGAGCGGGGCGGCCTACTGGAGAAGAACTGAGTTCTGTTGCACCTCGAGGAGGTATAGGTCGACAGGGCTCCGCCCCGAAGTGATCCGGACTCTCTAACA
CGGACCGTGTATGCAAGCCGGGCTTGTTGGTCGTCCAGGCGACCGTGGAGGGATTTGAAAAGCCGTGGACAGTTCTGATTGACTCCGGGGTGTCGGGCAA
TTACGCTCGACGCTCCACGATGGAGGGAAATCAACGGTATGTTGGAGCGCTGACAGCGCAAAGGAGTGACAGCGTCACCGTTCGCCTGGCGACGATGACT
CGTGTCACGGTTCCTAAGGTCGTGGTAGACCTGGGCGTGAAGTTCCTGgacttcgacagcatggaGCGCTGTCTGGTCCTAGACCTGGATTCGAGGTACG
CCCTCATTCTTGGCATGCCATGGATCGAACGCCATGTGCCATGGATCGACTGGAGGTCGAAAACATTAGGTGCTACGCACTTCTCGCCTGGTGGAGCATT
GGCGAGTCATGAACTCATCTCTACTAGGAAGTAGAAGCGCTATTGGCTCGAGCACTGGGCCGAGTCGgccatggtgctggacatcGGTGTATCCGAGTTG
ATGGATAACGCTGTTGTCGGGGATGTATCTCCCGAGCACGGCTCGCCGGACCAAAGTGGAACGACACGTACTCCGTTGAGTGTTGAGCGTCGGCATGACG
CACCACTGAGTGCCCACGTGAGCGCTATCGACAGTGTGTCGAGGCACCCTGGACCCGGTCCGGACGGTGCGCGTGCGGTGGGTCTGCTTTCCCCAAACCA
AGGGCGTATATCGCCGTGTGTCTTTGAGTACACGGGTTCCCACGGGAACGGAGGCGCTTCCGCACCTGGGCTGAGTGATACTGATGTCGCTTCGCCGCCC
TCTTGCACCCGGTCTTGGGCGCGGAGGAGGATGATACGCAAAGCGTCTGCGACGTCGGATGAGGTGTCCAGCGTGTCGAGCAGCACCCCAcgcgactgca
gcgagcaGTTATAAACATTCGTGAACGGAGGACGGGAGAAGTCGATGGCGACATCAGCCTTGAGGctcttctcgagctggacgagatgtccatcgccgag
ttcagcGAGGCCTTGAAGGCGGGCGATTTCGCTGAAGTGGTCATGATACAACCTGAGGAGGAATTTAACTACTCATCCCTCGTGGACGAATCTGTCCTCG
AGGAtaccaagaaggcgctcaatACGCGCAGTGGATCCGAGATCCTTAAGGATCCCTCAGTCCTGTTCTATCCATTGCTGATAGAGTATAGAGACGTCGT
CTCGAAGAACCCGCCTATGGGTCTGCCTCCGGATCGAGGAGTTCGTCACGCGATTGACCTGGTTCCGGGAACCAAATACTGCGTGACCAGGCAGTGGCCT
CTGCCACGAGAACAGTGCGACGTCATTGATGCGTTCTTCTGTGCAAAGCACGAGGCTGGTCTGGTGCGTGAGAGTAAGTCTCCACACTCTACACCAACAT
TCTGTGTCAGAAAGCCGAATGGCAAGTGGCGCATCATATATGCTTTCAACAAGCTGAATGCAGCCACCATTCCGGCACAGACGCCAATTCCTCGGAAGGA
TGTTCTCCAGAACAACATGGTCGGCTGTACGCTGTACAGCGCCCTCGACTTGGTCGCTGGTTACTACCAGTTGCTCATGAGAGCGAGTGACATTCCACTG
ACAGCCGTCAGAATTCCGAGCGGCATGCTCTGGGAGTGGCCGGTGATACCCCAAGGGCTGTCGAACGTACCGGCGACGTTCAATCGTCTAGTGGCGCAGT
TATTTCGGACCCATCGGGCGTATGCACAGACGTACTTTGATGACATATTTGTCCATAGTCGTGCAGAGCACGGGAAGTCAGATGTGGAGAACCACGTAGA
CCATCTacgagcagtgctcgagtGCATGCGCACCAGCAAGTTGTACGCCAACGCTGACAAATGCGTCTTCGGTGCGGAAGGAATTCCGTTTCTTGGGTGT
TTCATTGGGAAGCGAGGCCTTCGAGCAGATCCCGCCAAGGTTTAGGCCATTGTAGACTAGCCGGCTCCAAAGAACCAAAAGGACTTATGCAAGTGGTTAG
GCCTCGTCAATTACTTGCACAAGTACAGCGAGAATTATGCTGAGATGGCAATGCCATTGTCGAATCTCCTTAAGAAGGATGCTGAGTGGTGTTGGGACAC
CGAGCAACATGGAATCTTTGAGGCGATTAAGGAGAGCCTCCTTCAGGCGCCGATCCTGGCGCTCCCGGACCCGGACTGTCCGTTTAGCGTCGTGTGGGAC
GCGTCCGACTTCACTATCGGATGCGCTTTACTTCAAGCGGACGCCGAAGGGCGCGAACGCGTAATCGCGTTTGAGTCTCGGCAGctcaaggctgctgaga
agaACTACCCAGTTCACGACAAAGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCAGGGCCCACCTGCTCTGCTCCAGGCCTTTCGTGGTTTACAG
ACCATGCGTCATTACGCACTGCAACCCAGAAGCCTCACCTCTCTCAGAGAATGGCCCGATGGCTCTCCTTCTTTGTGGAGTATAACTCCGAGGTGAAGTA
TAAGCCGGACAAGCAGAATGTCCTGGCCGATGCGTTATCACGCAGATCAGACTATGAGCTTGTTCATGTCACGACTGTGACATCGTCCGTGACAGACTTT
ATTCGTGCAGCTTACGCACGTGACGAAACTCGCGTAGCCCTGCTACGTGCTCTTGGGAGCAAATAATTCCCCGATTCAGACACGACGATGTCATCACGCT
CTCGCGTGGTGGCCCCTCATGACGAGGACTTGAAGTATCGCATCTTCTATGAGGCCCATGATACCCCACTCGATGGCCATCTGGGTCGTGAAAAGACCTA
CATCGCTGTCAGCGCGATGTACTGGTGGCAGAAGCTGTACAAATGGTCCAGCACATACGTGCGCACGTGTGAGACGTGCCAACGGGTGAAACCCTCGCCG
CATTCGGCCGCACCTTTGGCGAGTTTGCCAGTCCCTACGGGTTGTTGGCAATCCATGAGCATGGACTTTCTGTTTGGACTGCCGAAGGACTCGGCGGGCA
ACACAGGCATTGTGGTCTTTGTCGACCGGCTGAGCAAGATGTCTCACTTGGCGGCTGTGGCGGACTCCGTAGACGAAGAGGGTACAGCCACGCTATTTCT
CGATCGTGTCTTTCGACAACATGGTCCCCCCGAGACGTTCGTCTCGGACCGAGACCCCCGCATTACGGGAAAGTTCTGGAAGCCCGTCCTCGCGGTGCTA
GGCACTCGCTTGGACATGTCCACGGCGGGTCAGATTGAGCGCGTTAATCGCGTTGTTTAGGACGTCCTCCGCAGTGTGCGCGCTGAAACGCCGAACCGGT
GGAGCGCcatgccccccccctcgTTGAGGTCGCATTGAATAATGCGGTGCACGCCTCGACAGGCTTCACCCCGTTCTATGCCAACGGCTTGACCCACCCT
CGTGTTCCGCTAACACCGCTACGCAGtggccttgggcttggtGGGGGAGGAGAAACCGACTGGCTAGCTGATGTCAGCCCTTCTGCTGTGCGTAAACAGG
TTGAGGACTTCTTGTCAACGCGTCTCAATGTCCTTCGATATGTGCGTGACGCAATGGCTGAGAGCCAATATGTTCAAAAGGAACAAGCGGATGCGAAAGG
AAGAGGCAACGTGGAAAACTTCAAGGTCGGGGACCTGGTTTTATTAAATGCTAAAAACCTACCTACGCATGCAGTGTCTGCGGTGGGGAGCACGAAGCTC
CGGCCTCGCTTTGTGGGACCTTTCAAGGTCATTGGCGTACACGGCAACGCGTACACGCTGGATTTGCCGTCGGCAATGGCGACCCATCCGACGTTCTACG
TCGGCTTGCTCAAAGCCTATCGCTCGCTGGATCCGGGTGACCCGCCGCATATTGACGCAGAGCGTCCCGCATCACAcgatgcagcaggtcgcCCTGAGGC
GGTGCCGCCCCGGGAGCCGAGGCAGGG