Description :
From Genome Similarity Track
Location :
Scaffold_15:576595- 578243
Transcript NameFunction/comments
Sapdi_VS20SDRG_05754hypothetical protein

Sequence
1648 bases(100 bases per row)
CTTGGTGCTGGCCGAGCTGCGCGTGGATGCACCCCAAGTTGTTGAACAGGATCGACTAAAATGGACGGTGAGGCGCTAGAATGGGATTTGAGATGACGCG
CGTACGTCATCGACCGAGCCCTTCTTGCACGACGCGACGAGCTTGATCGACTTTTTGAAATTGCGCCGGAGGTACTCGAGCTGCGCCTTGAGGTAGAGCG
CCGCCGTGTTCTGCACCGCAGGCGCAGGTACAAAGATGGCGCCGATGCCGACGCCGAGCGAGGACGGCGTCGTCGTCACGGTCGCCGTCGATGGCTCCTT
GGGCTTGATCTCCTTCTGGAATATCTCCATGGCCGACTTGACTTCCTTCTTCGCCACTTTGGCGTTCTCGTGCAAAAGCGCGACCTTGGCCTTGTACAGG
TGGAAGCGGAATTTGAACTCGACAAGGCTACGCTCCTTGGCGGCTTGGTCCTTGACGGGTTCTTGGTCGTCGGCGAGACCGTTGAAGCCGTGCGGGCTTT
CAAGGAACGCAAGGAGAGCGTGCGCCTTTTGCCGCATGTTGGTGAGCGCCGACTCGGACATGGCGCTGCTCCGGCTGCTGTGCAACAGTACGTCGAGATA
CAGGAAGCAAATGTGCATGGCCACGACCTCGTCCATCGGCTCCATCGCGCGCAAAAGCGCATCGAGGAGCGAGGATGCGGACGCATACTTTTGCTGTCGA
AAGTAGCACGCTGCGAGGTTGTAGCGCAGCAAGGTGGCGTCGCGCTCGGTGGACAAGCTCTGGAACGAGAGGTTCACACCGCTAAAGACGATCGAGCGCG
GCTTCTCGTAGTCCGAGTCGTCGTCCCAGTTGTCCTTCTCCTTGCGCAACTTGAGGCCAAGCCCGAGCATCGAGTCGGCGTGCTGTAATTGCGACACTGA
GCCTTGCATCTCCGAGAGCAACGATGCGAGCGCCGTCTCAAACTCGGCGGGCTTGGACTTGCCGGCCAACAGCTGCGCCAGCGCCAAGTTGTGCTGCACG
CGCGACTTCATCGGCCCCGCCTTCTCCTTGCTTCCCTTCTTCTCGCTGCCATCGTATGCGCTCAACTGCCCGAGCAGCTCGACGGCGTCGGCGTACTTTC
CTGCCCTATGGCCGTCGTCAGCCCACGCCTATGACGAGACCATGCGATCGGTGGGCGACGCCACCCATCTCCATGACTATGGCATGTACGTACGCCAAGT
GGGCTTGCGCCCGCGCCGCGACCGAGCTCAAGCTTGAGCCGTCCATTTTCGTCGCTGATTTCCTTCTGTGTGGTCGCCTCGAGTTTGAGGACGGTGCTGG
TCGACACTGGCATTGTATAGTATACTTTAAGCAAGTGCTTTGAATCAGCGTCGTCTTGGGGCCGGCTCGCGCATTCTTTTGCGTTCTTTTTAATCCTCAT
ACAAAATACAAGATATAATGCACGCTTTTATTATATTCCAACGGTGCGCCGCGTCGGCGCCGGCAGACACGCGCCCGACGACGCTACCCTGGCAGGCGCA
CGGACGATGGCTCGGCAGGCGCAAGAAGCATGGGCTGTCGATCGCCCATGAGGCTGCAGGCGCATGCGCCATGCTCGAGCACGGCGCTGTGGATGCGTGG
GCTATGCCAGGAGCGGACCTGGGGCCGAAGGATCGCTCTCGCGCCGCT