Description :
From Genome Similarity Track
Location :
Scaffold_75:57650- 59081
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12168Hypothetical protein

Sequence
1431 bases(100 bases per row)
ACGCACGTCTCGACACAAGGTCCCACGATAGACGCACAGCGGAGCATTCGCGGAACCGTCAGGCATCCATGCGCAGATGTTGATCGAACATATGGCGTCC
GTCTCCGTCAACCGGATCTGTCGACACCTGCGATTTTCGTACATATTGCGGAGGTCAATAGTAAAGGCGCACGCAGTCTTCAAGCACGAGTGGCCTGTAT
GCAGGTTACTTACACACGATCGTTGGCGCAATGCAACGTGCGCGGCAGACTTGCTTTTGCTCTGTTCCGCGCACCCGCCGACGTTTCAACTACCAAGTAG
TATGACGGGTATTCCTCATGCCAAGGCCACGTCGCCCCTCGACGACTACAACGTTGCGAGCACACCGAGCGACGAGACACCGACGACGCCGGCACCAACA
ACAACGAGCTGGACCACCAAGCGCACGCGCATTGCGATTGCGATCGTCGCCTTGACCGGCGTGGTTTGCGTCACGCTCGGCGCGATCTTTGTGTTCCAGA
CGCACGTGACCAACCACGCGACCGAGATCATCACCAACATCCAGCAAAGCCCTGGGCTCAAGATCTCGCTCCGAGCCAAGCGCGATACGATGACATTCAA
CGGCAAGTCGACCGCCGACGTGTTTGTCGTGCCCCGGGGTGGCGCCGGGTCCACCTTGCTCTTTGATGCGCTCTTGACCCAAGTGGGCCCGGAAATCACC
GAGACGTATCTTCTGCTCGACCACAAGGCGTACTATGCGACGTCCAAGAACGGCGTCGTGGTCTCGGCCGAGTGCCTCGACGCCGGCCGTGTGCCGCCCG
TCCAGCTCATGCAGACAAGCCTCCACGAGTCCAGTGTCCTTGACAACTACAAGGTCGCCAACGTCACGATCGCCGACTGCCCGGATGGGAAGCTCCTGCA
TGTGTCGTTTGCGGGCGAGTCGTTCGTCTTTTGCAACTCCAAGAACAACCTGCTCACGCACGCGACCGGTACGGACCTCGACATATCGGTCGAGTACCTC
TCCGACCCGACGCTCGTGCCCGAGATGGAGATTCCCGTCTTGCCGAACGGTGAGCCTTTGACGTGCGCCGCGGTTGTCGCCGATTCGGTACTGCCGGTCG
CCAAGTCGCTGATGCAGACGTCGTCGGACGTGGCCTCGTACGTGGCGGGCTACGAGCGCTCGACGGTCATCAACAAGGCGTCGTGCGGCTGCAAGATGGG
CAAGAAGAAGCCGTGCCTCTTTGTGCACGGTGTCGGCGAGACCGAGGCAGGTCCGATGACGCCAACGTTTCCATCGGGCTGGGGCAACATCCAAGAACAC
GCGCCGTGCTGCTCGAGCGTCCAGTTTATCCATCTCGAGACGACCAACCACCGCTGGGACGACGCGTCGACGCAGCAAGATTTCTGTGACGCGGCGCTGC
GTGTGAGCAAGGCAACGTCTACCAATGGGAC