Description :
From Genome Similarity Track
Location :
Scaffold_1774:5765- 6970
Sequence
1205 bases(100 bases per row)
CACGATCATCACTGGTGGTTTTCGGACTTGTCCCTTCGCGGGGATCAATGATTCAGCAATCTCATCTAGGTGTTCGCGTGGGGTAATACCCGCGCCCATG
ATGGCTGCCAATCCGTCCTCATCACGCTGGACTTTGCGAATCCCCATATCCCAGTGAGACAGAGTAACTCCCCACGGAACACATCGGCCATCCGCAGACT
TCGACTTGATTACCCATTTCAGAGCGGAATATTTCGTATAGATGATCAGAGGACAGCGGTCGAGAATTGTCTGAAAGACTTGCAACACTCGCATAATCGC
GATGACTTCCTTTTCAGCGATATGATATCTCAACTCGGCGTCATTCAGAACGCGACCTGTATACCTCACTGGTTGGATGACTCCGTCGTATTCCTGATCT
AGGACTGCACAAGCGGCCCACTGTTTCGCATGTGGAATAATGATGAACGGCTTCATCCGGTCCGGATGACGTAACAGCGGCGTCGAAACGACCTTTCTCT
TGAGTATCTCAAATGCTACCTTGACCTTAGTCAGATCACGTCCCACGCGCACCTGTTCGTCCGAGAGATCATATAGTATCGCAGCCACCACCGAAAAACC
TTCAATGAACTTATGACAGTAGTTCAGACTTCCGAGGAAAGACTGGACACCTTTTCGAATCTTCGGGAACGGCAGATCTCGAACTCCTTTCGCAATCTTC
GGAAGCGCTCGGATCCCCTCAGCACTAATCTCATGGGAGAGGTAGGAGATCGAGCGCTTTCCGAATTCACTCTTCGGAAGCCTCACAGAGATGTTCCAAT
ATCTGAAtcggaacagcagcgcgttcagGTCATCACATAGTTGGTCCCAGGTCTCGGCTCCATGAGCGATGCCATCGATATAGGAACTACGTCCCAAGAC
CGAGACGGAGCAGAGATGTTTCGTTTGAAGGCAGTCATAAGGTCGGTCAGAGGTTGAACTTTCTGAGCAGCAATCTCGCGTTCAGACTTCTCGCTTTCGA
ACGGGTCCAGACCTAAGAAATCTAGAACATTTTAgtccgcctccgcttcctcctcgggTGGAAGCCTCACAAAACCCCATAGGCAGTTGTTGATAACAGC
CTGGTAGACGAGTGGTGCGTTCTTGAGTCCAAACGGCATGCGAACCCACTGGGAATGTCCGAACGGACATACGAACGCAGAAATCAACTTTGCTCGTTCT
GACAT