Description :
From Genome Similarity Track
Location :
Scaffold_1:576475- 580374
Transcript NameFunction/comments
g181.t1OWZ24106.1 RxLR effector protein [Phytophthora megakarya

Sequence
3899 bases(100 bases per row)
TGATTCATGTTGCCGCCCGGTACAGAAATCACGATGACGATCACTTCATCAGCAGCGATAGCGTGGATCCCTCACTCACCCCAGCATCCCAGTCGTTCGA
TGTTGGTCTCGCAGCAGAACAGCAGAGCGTTTACTGCGTAGCCCAAGCTCATGATGGAGCTACCACTTTCTCGGTCTACGTGCCAGCCCGTTTCAGAAGA
CCCGGTCTGTCTTGGCGCGCCGGAAGAGTGTTCAATTTGCCATTCGGGAAGTGGATCCAGTGGATCGCCAACGACGTTCGCGATAGCGAATCCCCGCCGG
AAATATTCCTCCTCACAAGCTCAAGTTGCGAGCGTCTGCAGTTGAGCGAGATGCTGGTCATAACGCAGCCATTCTTCGGTGAATAAACAAACGAGCGGGC
TTCCAGGCTCCAGGTCAAACTACCTACAAGCACCGACCATCGCCAATGTTTCGCCTCCACATCGCAGAATTCGTCGCCAATTCCGTTCCGGTGTTGTTGC
TCCGAGCTTCCTGTCCACCATCGTCGCACGGCATTTCCCGATCGCACCGTGTACAGGTCAAACTCACGGACTTGCCACGAGACTCCTTTCTTACCCGATT
GCAACCGTTGTAACGTGGACGTGGTGAGGAGAATGCATGGTGTTCTGCAATGCAAACTGCAATCCGAGCAGGTCGATCCTTGCAGGTAGCCTTCACTTAT
CGAGTAATAGTCGAGTCAGATACGGTAAGGCAGAGAAAATGTATTCGTCAACATTAACCTCGAGGTCATATAACCTTTATGATTGAATTGAATTTTACTT
TTGTCCAGACAGGTAACCAATGCTTTTGAAGACCAGTATACTTAATAACCTCTATGAATAAGTGCACCAGTAAGTCATACTTCCGAAGTTTCTTACTGTG
CACTTCTCAACTGTCTCTGTTTCAACGGGGCACTTTCCATACTTGCCGGCCGCCGTCGTACTGGCCGTTGCGGCACCCGCGCGTCGTCTCCTGGCCCCCT
CTGCCCGTGGCCACACCCTCGCCCGTCGGGCCAGACCTCCGCGCGTCCACCACCGTCTCCACGGCCTCCCAATTCCCCAGGAAACCTCCAGACCACACCC
GCAAACTTCGCCTCAGAAAGACCGAGCATGGCCACGCCGACCGACCCGCTGTCGGAGCCTGCGGCCGAGCCTCCTGTGGCCGCAGAGGCCGCGCGACTAT
CGCTCAAGGTGCGCACACTGGATCAGAAGACGTACCCGATCACCATCTGCGCGGCCGCCTCTGTGCCGCAGCTCAAGGAGGTCGTGGCCGCCGAGACGGG
CATCACACTGGCCCGCCAGAGACTCATTTACCGTGGCCGAGTGCTCAAGAACGACCAGTCGCTGGCTGCGTACTCGCTGGAGGATGGCCACGTGCTGCAC
TTGGTGGTGCGTGCCGCTCCGCTGCCGTCTGCTGGCGTTGCTGCTGCCGGCCACGGATCGGCCGATTCTTCTGCTCCGGACGCTGATGCTGGCCAGGCTG
GGCGAGCCTCTGACCACACTGCTGCTGCACACCAGTACTTGGCTACAGGATTCAGCTCAATGAACGGCATGGACGCGCTGAATGCGCGGCTGGACGAGTT
GCAGAGACTGTCTCAACGCGCGCGGTCGAGATCGCGTCAACGTCGAACAGCTCGTATGCCGCTGCCGCCGACAGATAATGATGAACCTGACCCGACCATG
GGACGCCCGGGCGGTGGAATCCCCAGCCGCGTGCTCATGGGCGCTACCATTTCGGTGCCTGAAGGGGCCAATGTTACCATGCCCTTCCTCAGCTCCATGA
TCGCCAACCTTGTCACGCAGGTTCATGAAGGTGGCGTGGAAGGCGAAGGAGTGACGACAGGAACCGCTGCAGATGGACGACATCATGTGTCGTTCTCGAG
TGAGGCCCTGGGTGGGGTCGCTGCTGCTGAAATGGGAGCGACCGCGGCGAGAGCGCTGCGCCACCACCGCCGGAATCGCGATGGATCGGGTAGTACGGGA
CGTCAACGCCATGGGCGACGTTCTTTTACTGGTGCTGGGCGTCAGGAAGCTTTGCGAGTTCGTACGGGTGTACTGTTCGCGTCGATGCGTGCGACGCTGG
ATGACGCGTCTCTCAATTTCCCAGCCGAGCTCGCCGCACTGCCGCAAGGAGGGGACAATGCAGCTATGGCAGAACTGCAGCAGCAAGTGGAAATGCTGCT
AACGCTGCTGGAGCGGTTTGGGCCACGACTTCGCCTTCTTCCTGCTGCGCTTGCCCAGCGAGACCGTCTGACTGAGCGCTCTGCTCTAGCGGCTAGTGGT
ACGGCGCCAGTTGAGTCAGCTTCAGGCAGCAGTAGCACACCCAACACGACCAATGACCCAGCAGAGCCAACAGTATCAACACGCCATGTGATTCGTGCGA
TCGAGACGCTGCAATCGATCGGAGAGGCCACTGACTTGCTGGCGCGCATGGTGCGCCATGCGTTTGTTCACCAACCCATACAGTTGCGCGAACCCATTCC
GTTCCGTGAAGATGCTGCCGGTGCTGCGAATTTAGGTGCTACTATTGCTGGTGACGGAGTAGATGCCGCGATGCAAGCAGCGAGTCGCACTGCAGGTGCT
CACGCTACTACTGGTGACAGAGTGATTGCTGCGATGCATGCAGCTGCACGAAGCGAAGGAGGTGTTCGACCTCGGTTTCGAGTGTCTCGAGTCAGGGCTA
TGGATCTGCTGGGCGAACGAACTATTACAGCGTCGAGAACGGGCAACACTGCTCCAGGATCGACCCCAGGCTTCCCAGTAGATCTAACGGGCTCTTCTAC
TCGTGCAGCGCCACCGGTGCCCCAGTTGGCAACTTCCGCAGATAGCAGTCGACCAAACACGCGAGCTGATGCAGCTCCAAACAATAGTATGGATCCTCAA
CTGCCTGCAGGTGCGCGCATCTCGATTCCGGGCATCGGTGGACTGCCTCTCATGTCTTCGGTAGTGTTCCCATACTCTCTGGCAGCCGGCCTAGGCGGTA
GCCATGCTACTACGACCTGGAACCTGGCGGATTTTGTAAGCCGGCTAACCAGTGAGCTGCCAATTTCCACTATCTACGGAGTCATGGCGGGTGATGCCAC
CCATCTACACCAGATCATGGCGCACATTGGCTTCGCTTTGTTCAGCGGCGTTGACGTTCCGCGGATATCAAGACCGAACCTTCGTGCTTGGGCCCAAGAC
CTTGTAGACGAACTCCGCCGTTTGTTGCGCTCGAATGCGCTGCCTGCAGACGTGCTGGATCAAGTGAATGGAGAGACTGAGCGACGCTCAGCGCTGGGGA
ACGAGCTTCTTCGTGTTATGGAGCCGTTTATCCCTGACCTCATCGACTACCTCGTCCGTGCCACGTCAGCTAGTCGGGTCGCTGCATTTGGAACCAGCAG
CTCAACATTTTTGCGTACAATGGTCCGGCAAGTTGTCCACCAACTCCGTTCCTACGCAAGAGACTCGACAGAATCCGAAGACGAGAGCGACGAGCGATTG
AAGCGTCTGCTGCGAGGACTACTAATCTGGTTCGGCATGAACGAGCACATGGCGGGCTTTGTCGTTGACAGTCTTCTATGCTGGACTGAAGGAGATGGCG
CTTCAAGTCGTCGCGGACGTACGCGCCAACGCGAGGACGCTACTAGCGGAGCTGGTGCTACTGACTCGTCTGCAACCAAGCGGCGACGTGAGTAAGACGT
CAAAGGAGCTGCTGTAGCGGGACCATATTGGTACCTTCAGCATTAGTCGAACTTTGCCTTGGATAGCAGGATAGGAATTTATCTACAAAAATGCAGCTTG
TCAACTGTGTCCACTTTTCCATAAGTGGAGTCCAAAAAAAATAAACACTTCCGAGTAAACGCCAAAAAGGCTTGCTCCGTTTGAATAATGCATATGAAC