Description :
From Genome Similarity Track
Location :
Scaffold_33:576446- 580412
Transcript NameFunction/comments
Physo_134750hypothetical protein
Physo_157031hypothetical protein

Sequence
3966 bases(100 bases per row)
CCATGCCGAGACTAAGATGGGCACGTAAAGTGCAAGCGCACATGTACCCAGGTCGCGATGACTTCACCAGCTTGTCCTTTGTGGGCCGCGTGCAGGCAGC
AGCCCGGTCCTTCGAGCCGTGTGCAATGGCGATTCACTACACCGCAGCAAGCGCCTGAGCGCGGCCAGCCACACTTCAAATCCTAGATCCAAAGATCCTC
GGATCTGTACCACCCAGCGCTGTGGGCGCACGAACGCAGTGAAAGCACTACGTTGTGGCTCGGTCCCGTCGGCCGCGACGAGAGGTACTGCTGCTGGTCC
AGCGCTGTCGCCACCGCTGGGCTCGGGGGTCGCCTTTTATTTCTCGCCCGACCATGTCTGCAATCAGGTTGTCGGAGGGGGGTGAGTTATCCGACAGGAA
GGAGCTGGACCCGACGGTTTTTTCCTCCGCTGCACGCATTTGTCACAACCACACTGCGGGACTGCCACGAACGCGCCCGCGTGGATGAGTGACTACGCCC
AATCCCCACAGACCCGCGTAGGCATGGGACTCTGCCTGGCCTGCATCACGGCGGCACCAAGTCCCGCATGCTCGCGGCCCAATCCTCGATCGTTTCACGC
CACGCGACAGGCGTCCAGTGCGCGTTCGGCATCTGCTCGTCCCGGTCGTCACGAATAGTAGGTACCGCAGATCCGTTTCGTTTTGTGCTCGTACTTCAAC
GTCGACGAGTGCTGCGCGGTACACCCGCTTGACCCGCTCGCTGGTGAGCGTTTGCCCTCGCTCAGCTCTCAGTCTGAAGCGGCTCGACCAAAGCGCCCAA
CGCCGCAGAAACACGAGACGCTGGACTACCGGCCGCGCTCAACGCCCGGGACAGGGGGTGATATCACTCGAGAGAGCTCGGCCCAGCCACCCGTCGCCGC
GTCCGCAAAGACGCCCCATCATTCCAATTACGGTATCCGAAAAGCCAGAAGAACTCGCGGCACTGTGCGTTAGACCCCGTGAGACCCCTCAACGGCGGCG
CGGCTCAAGCGCTCGAGCAGAGCTCTCATTCTCGAAAAAACCCGACAGCGTGAGAAACTCAATCAGTCCAACATGGCACTCGTGGCACCCGCCGACTGCT
GCTTCCAGGAGCTGCAGTTCGCGCTGGCGAGAGCCAACGCCCAAGTGCAGGCCACCACCAACGTGGCCGAGAAGCGGGCCGTGCGCGCACTGAAGAAGCG
GCTGCAGGACCGACTGTACCAGCGCAAGCACCGCGCCAAGCGCGAGCAGAAGCTGCACGCGCTCGAGCGCGACGTGCAGGCGCTGCAGAGCAAGATCGCG
CGGCTGTACCGCGACCTGCATCGCCGCAAGGTGGCGGCGGCCAACGTCGAGGCGCAGCGCCGCCAGCAGCAGCAACCGTGCCCCGTCGGGTCGCTGCAGG
ACCACGCCAAGCGCGTCGTCATGCAGTTCTTCCACGTGTACCAGAACGGCTACTCACTGTCGCTGGCCGCGCTGCAAGAGCGCTTCCTGCGCTCCGTGCT
GGCCACGGACGTGGAGGGCGTGGACCTGCGCGGGGCCGACGCCTTCGTGCAGCAGTGGCGGCTCTGCGACCAGCACTTTGCGCTCTACATCCTCGAGCCG
CAGGTCTGGAAGGCGCAGGACGTCGGCCACTCGGTCATGGTGGAGGTCGAGGCGATGATCTACCTGCGCTTCCATCGCCAGACCATCGGCATGCTCTTCC
CGAGTCTCAAGACGGGCCAAGTGGATCCGGAGCTCGTGCTGCCGCTCGTGACGGGCACCACCGCCGTCGCGGCCACCTACACCTTCGTGGTGGACCGCAC
GGGCTACGTGAGCAGCCTCATGGTGAGCGTGCAGCTGATGGACACGCTGCGGCGAGTACTCGGCTCGCTCGCGAACGTCGTGCAGCTCACGGACGGATGT
CGGATCGACCTCAGCAGCGGCACCATCACGATCGCGTAGAGAGAAGCTGCCAGTAACAGCATAGTCATACATGTCCCACACGATGAGTTTTTTCGTGCAG
TCGTTCAGACTTCCAGCGCTCGTCAAGGTGCACGCCTCGCAAAGTTGTGCAGTCGCCCTCGAGCGCAGGAAATATGATGGCAGAGTCCAGAGCGTAGCGC
GCGACGATGAGTCGCGTCCGTCCTGCTGGCTGGCACGCCGCGAAATTCGAGGCTGTCGTTCTGGTCGGTCGGCCGAAACCACGAACGATCGCGAGGGTTC
ATCCTGGACGGACGCGTTGAAGCGAAGCTGTTTGTTCGCTCATAGAATTGCAGCTAAACGACACGTCGAAGCGGTCTTGACGAAGGGCAGGAAGACGACG
ACTTCCATCGGCTTCGGTGACTCGGTGGCCGTGACCAAGACGTAGAAGCAGGGCTTGATAGTAGCGGTAGTTATCCTGAACTACTACCAGTAGTATTCCA
GTAAAAGAAAACGAATTACTAGTTACTGGGTCCTTTTGCTCAAGCGTTCCTAGCTACTATAGTAATAGTACTATAGTACTATCAAACTCTGGCTGAATGT
GGTCCACACACTTATTTTTAAGTATATTTTTCGGCAGGTTGTCACGAAGTGGTCAAATTGTTTAAATATTTTATATTATTTAAGGGTGTGACTTCGTTGA
TGGTTGACATGTGAGAACATCTGGTCGCAAACGGACGTGCGTTGTAAGTAGTAGATACAAAATCTCGCGATGTACCAACGACAAACGACACCAAAATATG
TAGACCCAGTACTTCTTACCGCCGTCGAACGAGCACAGGGGCTTACGACATTTTTTCCTATTATGCTGAGCAGCAACTTGCGTACCAGCGGCGGTGCTAA
AGTATTGCAATCAACACTCACCATTTACTCACCGCGATTAAACCCGAGTGGAGCTTTGGGCTGTGGGATAGACTCAGCAGGCGAGGGCGAACGTATGTGT
CATTTCAAGTTGTGAAACCTCAGCAGTAACTCGATAGTATTATTGGGGGCGTGGATGAGTTACTGGCTACTATAGTGATAGTACAATCAGAAAGTGTCAA
GTTACTAGTTACTATAGTAGAAGTAATAGTACTATAGTACTATATTTTACTGGCCTCGCGAATTACTACCAAGCCCGACAGCGCGCGTGAGCGGAAGAGG
AGAAGGGAATGCTCGACTTGATATAGAGACCACCCAAACAAAGCGGTCTTTACGTTCACGACTGGGGCATAAATACAGACGCTAGCGGCCCGCCCTACGA
CAGCAGGAACTCGACATTGTGCCGCGGGTCGACGCGCGGCTTGGGCTGCTGCTGGTCCACCGTGATCTGGCCCGTGGACGCCGAGATGTTGGCGTCCGAG
AGCACCGTCGAGACGTCGGCCAAGCTCCCGAGCGCGCGCTGCAGCGCGTCCACGAGGTCCCATTCGGCGCTGAACCACGTGATCATGCCGTGCGCGTCGA
AGGTGAACCGGTACTTGCCGTGGATGTTGATGATGCTGCCCGAGAGCTTCTGCGTGAGCTCCAGGTCGCCGTTGAGCGACGGGTAGAGCGTCACGACGCC
GTCCCGCCGCGCGCAGATGCTGAAGATCGAGTCGGCCTCGACCACCGTGAGCTCTCCGACCGTCGTGACGTTGATGGCCTGTGGCTCGTAGCGCGTGTAG
TCGAAGAAGCTGCAGTAGTGGCGCCACTGCGTGACGACGGTGTCCACGCCCACGTAGTCCGGGCCTTCGGTCTCAGCTGTCATGACGGCGCGCAGGAACT
GCTCCTGCTGGTCGATATGCAGCGGCGATGCGCCGAACTGGAACAGCCGGAAGTACTCCATGGCCACGCGCGCGGGGACGCCGCCCGCCGTGCCGCGCGA
CGCGAAAAAATTGTTGTCGACTAGCAATTTCTGGCGCTTGCGTGCGAGCGCCTCCACCTCGGCCGCCAAGCTGAGGACCTCGAGCTCGAGCGACGCGGCC
TTGGCCTTCTGCTTGGCGCGGTGGCGCCGCTGGTGCATCTTGTACTGCTGCCGGCGCCGCAGCACC