Description :
From Genome Similarity Track
Location :
Scaffold_20:576369- 580652
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007830Similar to ptma-A: Prothymosin alpha-A (Xenopus laevis)
Pytul_DAOMBR144PYU1_G007829Protein of unknown function

Sequence
4283 bases(100 bases per row)
AGGTTAAAGAGGCATGTGCAAACGCTTCGCTTTTGCTTCTCGCATTCCGCTGATTTATCCAAATCAATTATCGGTTCAAAAATCACAGCAGAGGACATAC
TGAATGTTACATACTCATGCAGTACCAACATGGCTGCATTGCGTCTGTAATGTAGCCATGTGGCATTCAACCACAGATCCGGTCACTGAGAAAGTACAAC
CAAGCGTCAAGGACATGACGAGCACAGCAAGCGTAGCTGCCAACACGCGTGCGCATACTAGGAGAGAGGGATGTCTTTAACGTGATGTAGCTGTGGTGCG
GATCAGATCAGATCGGTGTGCTTGACGCGATATCTTTTTTATATCCAATATAAAGCGCAGTTAGTAGAGCAAAAACGAGAAAAAACTGCGATTGTGCGCA
TGGTCTTGTCCATTTTTAAAGAAACCCCACAAAAAAAGAACGTGCCTTCATGCTCACCCACGCACCGGAAGAAGCGAGAAGAGCCGACACTGGGAAAAAC
GAATCCGTTAGGTTTGTGGCCCATATTTCTATACTTCCATGGCGAGCTTGGTGGCTTTATTTTTGTATCAGTCGGAGTTTGTTGTTCTCGTTCTAAGTTG
GGGGTCTTCGTGCCATCATCCACTCGGGGGCTTTCAATTGTGAAAACGAAAAACACCGCAAGCCTCCACGTGGTTCAACAAAACGGCGCACGCCTTGTGA
GTATTTTGACGCGCGACTTTTGAGACAACAACTGATTTTCCATAGCTCTTTACATGTCGTCAAAGATGCGCATCGTGCGGTCGCCAGCTGCACATCCTGC
CGGTGCTTCTACGACTTTGCCAAACAGTAACTGGCCCGAGAACAATCATATCGACGATGCGCATGGCGAGAGCAAGAACCTGAAAAAGGACGCGCTAATT
AGTGGAAAGCAGCATAAACAGCTGCGCAAACAACATCAACCATCGTCAGCCTTCCCAGCTACCGAGTACCTCATGCGCACCGTCGAGGACGCGATCTATG
GAGGCGGAGCATTCCAGGGAGTGTCTGAGCATCTGATCCTGGACCTTTTGGACTCGGCGAAACGCGAAATTAAGGCTCAGAATCAGCGAATCGCACAATT
AGAGCAGCAGAATGGCAAGTTGGCGGCTGATTGTTCGCGGTATCGTACATCGGTGTCCAAGCTTCAGTCGCACTCGGAAACATTGCGCGATATTTCCAAT
GGCAAAGAGTGAGTTCTCATGCGATATGGTGGAGTCGCATTCGCACGTACCCACAAGCACGATATCTAACGCCCCTTCATTTTCTTTGTTGCCTTCCAGC
AAACATGTGCAGAAATTGGTGGCTCTTCTTCGAGAAGTCCACGGGTACGAAGAGCCGGAACTTCCAGAGGATGAAGAACAGCAGCAACAGGATGACGAGG
AACATCATGACGCAATGACGCAACATGGTGATGATGATGATGAAGCCGGGATCCATGGATCCGAGGACCAAGAGCTGGATGGCAGGGAAAACGATGAGTC
GCATCTGGTTAGCTCCAATCAGACAGAAGAAGATTCACTCGATGACACACAGGTCCAAGTCCACGTACTTGAAAATGATCTCGCGCGAGTCAAGACGTTG
ATACGCAGTGCTAAACTGAGCAACCTTGATGCCGATAAAGCCGATGGTGTACTTCATATTGCCCCTTTCAAACAGCAAGGGGGGTGCAAACACGGCGTCT
CGCCGATGTTCTCGCTGACCCTTGCTGAACCGATGAAGAAGGTGATTCAGGAGCCAAAGCCACCACGAGGGTGCAAAGTCGCGGTAACTGGTGATGGGGA
ACTGCGTGTGAGTGCTCCAAAAAGCGCGAGGCTCAAATTTCAGTTCCCAGATTCAGGATTGAGCACTTTTCTTGACGAAGGCGAGGATGGAGCTGCAGCG
AATCGAATCACACTCGTAGAGTCTTCACCGACTCGGGCATCGTCGCTGTCGCATAGGCGCCGCTTTAGCTCGAGCTCGGTGATCTCAACCACGGTTCCGT
TGCGAAGAAAATCGTTCACCATGAAGCGAAGCCCCATTAAAGGCATCGCAGTGACTTCAGAGAAGGATTTCCCAGCTTCAGACCCAGCAATGAGCACTCC
AGCAGCAAACAATAACGGGCCGAGTCGATGGACAACTCGTCGAAAGTCCATGAGTGCATACCCCTCCATCTTAAAGAGTGCGAATACTCGAAGCAGTCCA
GCGAAGTTCAAGCTTAATGCGAAGGATGGAAATGCTGAAGGCTTGAAGGGGTTTGCTCAATCTTTGCCTTCTCCGCGCTCGTCGCAAATCATCGTTCGCG
TGCGAGAACGGAAACTGGACGGTGTCCCTGAACTTGTGATTCGCAAGAAATCGTCCCGCTTCATTGTCTGGCAATGGAACGAGCGCCAAGTACGCATTCC
ATTCATGATCCAGTTGGGACCCCATCAGCACGGCATCATGCTGCGGCAATTGCGGTACGTGAAAAGCGTGATGCATGATTTCCCGTGGGCAAAGGCGCAC
TTGAAAGATCTCTTATCGTCCTACACCAAGAAAGACATGGCTAAAGAGCAGCTCTACCCCCAGCTCAACCATCTTAGCCATCACGTGCAAGACGAGATTC
GAACCAGGGTGAAAAAGCAAAAGTTACTTACTGCAAAGAAGCACTACTTGACGACGCAATTGACCATCGCTGCTGGCGTGATTAACGATCTCCATATGAC
GAAATTTGGACGCCGCGGCAAACCGCACGAGACGAAGCTCTGCTACGACCCGAGCGATCCGACACGTCTCCATTGGCTGCGGAAGAACGGTGAAGAGAGC
GACGAGTTCTTGCCAGTCCACGAAATCAAGATCCATGGCGACTCGAAACTCGACACCAATGTCATTAAACGCGCGGCGCGGAAGTATCCGTTGGATCCAG
AATGTTGCGTCTCGCTTGTCACGAGCGTCCGCAACCTGGATCTTCAACTGAAATGCCCACTGCAGCGGGACTGGCTTATGAATGCGCTCCATGACATCGT
GTCGTTTGCGCGGCAGTACCGAACTGCTGGAGCCATTGGCCGTCGCCAGCAATCGCAGCAGGACGTTCACGCGTTGGCCGTGTACAGGAGATAAAAAAAA
AAGAAGCAAGCAACCGATATTGCTCACCGCTTCGTTTGGCATCTGTGGCAGGAAAACACAGCAGTTCAGAACAGCATTCCAAGTTAGTGCTTTACACATC
TGGACTTACCTGACCGTGTCTAATGAGAGGAAAACAAAACGCAGTCAATACAACGCATGTGCAACAGCATATACAAAAGACACACATGTTTTTCTTATAT
GACGAACAATACCGAAAACAATATGTGCTTCACATAATCGGACTGCATGAGGCTTTCAAAGTTGCAATAGGAAAGAGCTCTGCTGACGTCTGATGCTGTC
GGCCATTTCTTCGCTTCTCTCTTTCCCCTGCTACCTCGTGTCGCCGTATCTTCATATCCTGCATTTATTTCTTCTTCTTGTAGTGTGGCTTCTGGGTGGA
CACAAGCTTCGCGACGTAGAACAACGACATCGCTGCGCTTGAGGCTGCGACGAAACCAGCAGGGAAAAACGCGCCGGTCTTCTGGTAGCGCATACCCATA
ACGCCGGTCAATGGCGCAGACACAACTAGGTAGTTCCGGAACCAGCACAATATGTCAGTCATATGAAACACGACTAGCAAAGAAGCACAATACTATACGT
ACGCAAGGAAAGCGCAGGCCACAACTTGGACGTCACTGGGCTTTGCTGGTATTCGTTGTAGCTGCAGTAGCCGACGAACGTGAGGAAAAGACCCGACGCG
CCGCCCGCGATGGCCGACGTCGCGCTGCCAGAATTCACGTAGCCAATCAGGCCACCAATGCCCAAAAGCATACCATACTGCAGAACAGATCATACAATCA
GCCACCGTGTGAGTCAATATCATATCTAAAACTTCCTGGGATGGAATGGCAAGACCTTTGCACCCAAAAGCCTTCTGAACATACTTTTTGCATGAAAAGA
AAGCTCTTTGCACGGCACATGCGACTGACGCAGTTCCGACCTTCCTAGACGCGCATACGGGGAGAGACACGTACCGGAATCGTGAGACAAAAGTCGTACA
TGGTGCTGTGTTGTGTCTGCGTGCGATGCGCCAACTGGAAATGCGGCGAGTGTGCGCACTGCCTTCTTCACCCCCAGAATTTGCTTTTCCCCCTTGATTC
CGCAACATGATTCCATTTCACATACAAATCACAAGCTTTTGGCAGCTTTAGTTGCCAAATATCAATTACTTGCATTCTGATTG