Description :
From Genome Similarity Track
Location :
Scaffold_38:57635- 62029
Transcript NameFunction/comments
Phyra_79196ubiquitin family protein, putative
Phyra_71687ATP-dependent RNA helicase DBP2, putative
Phyra_95316Hypothetical protein

Sequence
4394 bases(100 bases per row)
GTCCAGCTTCCCGAAAGCTGATTGTTCGTTGCTGCCGATTGTGCACTCTTCGGCGGAGGAGCTTGCCATTTACATCGTACGTGCGGTTGCTGTTTGAAAT
CCTACGCGGAAGTCTATATCTCACAATTATCTCTCTGCTGCCTGGAACAGAGCAACCAGCTCGTGGACGCATTCACGCTGGTTGCGCTCCTGGTATGTTT
ATGCCACTATCTGTTGCCTACTCCAGCTTGCCTACTGACCCTTTAATGTATTGAACTACCGAATCTGCAGGAGCGTGGAGTTCGGAAGCTCGAGGTGAGC
ATCTCGGAGGCCAACCAGCAGTTCGCCTCGTACGAGCGCACCATCTTAGCGTAGGCGGCTTAGAACGCACTTTTGGGTGCGAAATCATCCCAGTAAACCC
TTCGGACCGAGGCAAGGACCCCGCCCCACCGTCTTCTGCGCTTACTGCAACGCACAATACAACGGGCTCATGCGCTCTCCATCATCTTCGTGCGGTCTTG
TCTTTTGATGGCTCAAGAATCTTGAGCCATCAAGATCGTTTTAAAAAAAAACGTTTTGTTTCGTCCAATCACGGCCGGTTATGCGAATTTTCCACGAATG
GCGCGAGCTGCGACACCTGATTGCAGGAAAAGCCGCCCGCCCGTCAGCCAACCAAAAGCCGCCTGTTACCGTTCCCCTGCCCAAAGCGATCGCTCTCTGC
CCCCTGTCGCCCCAGTGCGCACTCAGCCCATTCGTCGAAACGACCCGTGGCGCGCAAGTGAAAGCGGCAAACCATCACTCTTGATCATGTACGGCGGCGG
CGGTGACCGATACGGCGACTCTTCCTCGCGTCGTGACTACGGCGGAGGCAGCAGTGGTGGCTACGGCGGCGGTGGTGGCGGCGGCGGCTACTCTCGTGGT
GGAGGTGGCGGCGGAGGCTATGGAGGTGGCGGTGGCTACGGAGGCGGTGGCGGCGGTGGATACGGTGGCGGCGGCGGCCGTGGGGGAGGTGGCGGTTTCG
GTGGAGGCGGCGGTGACCTCGGCTCCAATCTGGACACGCACATCCAGTGGGACATGTCGAAGCTGCCGGTGTTCGAGAAAAACTTTTACTACGAGCATCC
GGACGTAACCAAGCGCTCTGAGGATCAGTACGATCAGTGGAAGCGTGAGAACCAGATTATCGTGTCTGGCAAGGGCGTGCCCAAGTGCGTACTGTCGTTC
GAAGAGGCTTCGTTCCCCGAGTACGTGCTGGAGGAGGTGGTGCGTCTGGGCTTTGACAAGCCCACGGCCATTCAGTGCCAGGGCTGGCCGATGGCGCTTT
CAGGACGCGATATGGTGGGCATTTCGGCGACAGGATCCGGCAAAACGCTGGCTTTCTTGCTGCCCGCGATCGTGCACATTAACGCACAGGTTCGTAGTTT
GAAGCAGACTCTTTGTAGAGGCTTTTGGTCGTTGTTGGACGCATCTTCCGTGGCGCTGGTGCGCTGATGGAGGAGTTAGCAACGTTGTGTCAAGCACACG
ACGATCGTTCGCGCATATGATGCGATGAGCGAGTCACACGCGTGAGGCGTTGGGGTTTGGATACGGTCTTCAGAGCGTGGTCGATCCACACGGATGCTCG
TTTAGTGGAGAGCTATTGTGCGATCCTAGAGTAAGCGGCATTCGCGTGTTTTTCGTCACTTCAGTTGATTCGAAGCGTGATTTGCTGTGTTGGAGTGCCG
GTCGAACATTTGACGGAGAGAGTTTCTACGACGGCTTCGGCTGTTTGGCTCGGCACGATCGACACGCATACAGATAGCAAATCTTGGCTGCTTTCTCGAC
GACCACCGGCGTCTTCTCGGCGATCAATCGGTGCGAAACATGCATTGGTGCGTTGTCGGCGGTGGCCAGAAGAAAGAGCAGCACGCGAACACCTCAATCC
CTCGGCGCTCGCTTGTGTTTGCTTTCTCGTGCAACTTCATATGCTCGATTGCATCTAAGTGGTTCCTAACTTTTTGTGCTTTTATTTTATGCTGTAGCCG
TACCTGCAACCTGGCGACGGTCCGATTGTTCTGATCATCGCTCCGACCCGCGAGCTCGCTGTGCAAATTCAGGCGGAATGTAACAAGTTTGGCGCTAGCT
CCAAGATCAAGAATACGTGTGTGTACGGTGGTGTCCCCAAGGGTGGCCAAATCGCGGACCTGCGTCGCGGCGTGGAGATCTGCATTTGCACGCCTGGTCG
TATGATTGATATGCTGAGCATGGGCAAGACGAACTTGCGCCGTGTAACCTACTTGGTTCTTGACGAGGCTGATCGCATGCTCGATATGGGATTTGAGCCG
CAGCTGCGCAAGATCGTGAGCCAGATCCGCCCCGACCGTCAGACGTTGATGTGGTCGGCTACGTGGCCTAAGGAGATTGTGTCGCTTGCGAACGACTTCC
TGACGGACTTCATTCAAGTGACGGTGGGCTCTCTTGAACTGACCGCTAACAAGAAAATCAAGCAGATCGTTGAGGTTATGGACGACCACCAGAAGTACAC
TGCGCTACAGGACCACCTGCGCGACATTTACGAGGGAGGACGTATCATTATTTTCTGTGAGACGAAGCGTGGAGCCGATGAGCTGAGCCGCAACTTGCGT
GACACTCGCTACATGTGCAAGGCCATTCACGGTAACAAATCGCAGGAGGAGCGTGACTACGTGCTGCGTGAGTTCAAGGACGGCAAGACTCAGATCCTGG
TCGCTACCGATGTGGCGTCTCGTGGTCTGGATATCAAGGACATCCGCTTCGTGGTCAACTTCGATATGCCCAAGAACATTGAGGACTATATTCACCGTAT
CGGTCGTACGGCTCGTGCCGGTAACAAGGGTACGTCGATCTCGTTCTTCACGCCCGGTAACAATGGTCGACTGGCTGGACCTTTGGTGAAGATCATGGAG
GAGGCTGAACAGGAGGTGCCGCGTGAACTGCGTGACCTTGTGGGTCGCGGCGGTGGTGGTGGAGGCCGTGGCCGTGGTGGATACGGTGGTGGCGGCGGTC
GTCGCTGGTAAACGTTCCGTGCGTGACGTATTCACTTCGTAGTGGCGGCTAGCTGGGTACAGTATCAAGTAGAGAAGAAGGCTCCAGCGTTTGCTGACTG
CGTGGACTGGCAAGGATACAGTGCTGGTTGCCTCCGGTCTAATAACTTGCAATAAAGTGCTACGTAGTCATCACCAACTTGTGTGTTTGCTTCCAGTTCA
AAGCCCTACAAATTCACTACGGTATCCAGGATAGTATGTATTACTAACATTGCCTCTACAGTAGCTTGTTATACCATTTACATTAAACTGAGTCAGCGAT
AGAAAACCTCACAGAGAGCACAGGAGTGGTCATAACTTGCTCTTCTCGGTCTTCTGGAAGGAGTCGATCAAAGCGGTCGTAGTCCACGATCACGCGGTCA
CGCTCAATAACGGCGAAGTCAGCAAAGCGCATGTCGTACGCAAAATCGTCCCAGAAGTACATCTTGCGCGCGTACACATTCTCCGAGAAAGTCGTATCGA
GGCCTGTGAGCAAAGCGATGACTGCGACGCGCGACTGCGATAAGTCCTCCATCGAGTGAAACTTGTAGAACGGCGAGTTTTCGTTGATGACGTGGATAAG
TGTCGCTGGCAGCTTGATAGACGGCCACTCAGCAGTAACCAGGGGCACGTCGTACATCTGGCGCAGCCCTGTGCGTCGGTTTGTGAGGATCACGCCGATG
CGGAAAAAGTTCTCGTGCACCTCGCCGGAGTGCCTTGTATTAGCAGCTCTGAAAACGAGGCAACGGTGACCATAGATGGTCGAGATGGTCATCTTGGACG
AAAAGTGGATATGTGCTCGGGGTCGCGCAAACTTGGACCAGGCGATGCCTGTGATGATTGTCACGGCGATAATACCCACCATCGACTCAATGAACACGAT
TACATTCATGTAAACGGCATCAGGCATCGGGGCCATCGAGCCGTAACCGATCGTAGCAAGCGTATGAACACTCATGTAGAAGGCCAACTCGTAGTCGGAG
ACTACCACATCGGTGTACGCTGAGATGTGGCTCACGTCAAACCAGTACAGCAGACCAAAGCCGAAGTTCAGTACTAGAAACGATAGTACGAACACAACAA
TGATTTTTGGCCAGCCCACATGGAGAGCACTCTGGTAGAACCGCATGAAACTGAAAGACTTCGGGATGTGGACAGGAAGAATGCGCAAGAAGCGAGGCGT
GTCCTCAACCTCAATCGACACTGCAGACATAGTCGTTTGAACCCGCAACCGTTGCCGAGGAGTATCATCTTGGTCATAGTCATCTTGGTCATAGTCGTCC
TCCACACAGTCTTCTCCGTCACTGGCATCAGTGTCGACGTTGTCAGCATCGTCACTATCATCCTTGTGCCCTTCCTCCTGAGAAATTGTACTCG