Description :
From Genome Similarity Track
Location :
Scaffold_104:5763- 7735
Transcript NameFunction/comments
Sapdi_VS20SDRG_15854hypothetical protein

Sequence
1972 bases(100 bases per row)
GAAAGGTTTAGAAACGATATTAACTAACTGTTTACATGATCCAGCGCGAACGTTCGGCACCCACTTGGACGTCAATCGTGCCATTGGGATGCATCCCAAG
CCGCCCGAACGCAGAGGCATGCAACTTGCTCACGGCAATGTCGGTGCGATGGTCGAGATACATTGCGTCCGACAAGCTAAGGCGGTAGGATGTGACGTTG
TTGGGCGTATACGACAGCACGTAGCAGTCACTACCCCGGAAACTAAACGCGGCGTTGCGCTGCAGATGCTTGTGGGTCGTAAAGAGCTTGTAGATCGATC
CGCCTCGGAACGTTCTCGGTACCTGCTGCGCTCGTCAACAGCAGCCGCAGCCAAACACAAGACCGAGCAAGAGTCGGTGCTTCCAGTCGTTGTAGCTCAA
ACGGGCAAACGCACCGCCATCAATCGCACGGACGATCAGCGAGGAGCGGGAGATGACGCGCGAGAGCCGCCGGCCGGATGTGTGGGCCATGGAGCTGATG
CGACGGATCCACAAGCGACAAAGCACCTGACGTACGAGGCGTGTGAGCGCGGGCAATGCAAAGCTATAGACCAATGGAAACGCGCCGAGGACAATAGTGT
ACACAATAGCCGGCGGGATGTGTTCGACATAGTCCATCTCCTTGGATTGGGGTAAAAAGCACGTGTATAGCACGTGGTAGAGGTCGATAAAAAATGAGAG
CCGAAGCTGATAGTACGTCAGCGGTCCCACAACGAGCGCGACGCCGATCGCGACGCCGGTCGGGTCGGCTTGGGCGCAATAGGACTCGAGCGCACACCGT
CTTAGGACAAACCCACTGAGATTGAGCACGAGGTACCCAAACCAAACAGTCCGCGAGAGATACAAGGTTGAGATCGCGAATACCCACATGTCGGTGGTCT
GGTCGATTCGGAAAATGCACTGGCCGACCGTCTCCAGACTGCACCAAAAATCCACGACAAAAAGAGCGCAAATCCACGTGTTTTGGAGAATGAAGCTCGT
CGGATCTCCGACAATAATCTCCAAACGTTCGTGCTCGCCACATGCGCCGTATTGCCGCAGCCCCCTTGCGAGGGATCGGTAATGGACATAGTACGTCGTC
CAGAGAAGGTACAGTATACGAAGCGTCATACCAAATCGAAAGCCAAACTTACAGTAGCGCCACACGGATGAGCCATGGTCGAGCTGGACCGCAAAGAAAA
CATTGTCATGTGTGTCGATCCAGAGGACACCGATCGAGGACGGGAACCCGAAAAGCGTACCTGGCTGGACGAGCGCAGTGCTCGAGGCATTTCGGGTGCC
GAGGCTGGCGTCATGGACCCAGAGACGCGATCGTTTCGAGTAGAAAAAGGCGCCAGGAAGGGTCGCGTAGGTAAACGACGCCTCGGTCAAGTGCTGGAGT
GGACCAGAGAGAACATCGACGGCCTAGAGATTGAGAAGACAAATGAGATACTAGCCTGGTGGTGGCACTGCGCAGTACATGGAGGCGAGGTTGAGTAGAA
AGACGCTGGAGAAGAAGACAGAGACCTTGTTGAAGGTCACGATGCGCATGGAAACCAGAGACGCACTGGGCCCTGCATGGATCTGCATACCAACGGTGCT
GCAAAGGAATCAGGTTGATTGTTGAATTTGAACTGGGCAATGAGAAACGATGTCGGCAACTAAAATAGAATGCGGTATCGCGCTTGATTGGATGAAAAGG
TGATTTGTTGCTCGTCCATGGCTGATTGGGCGAACCAAAAGTATATACTAACTCGCCGAATGCACGTGGCCGCATCAAATTTTATCATTTTCTTGGCCTC
ACGTAGCACAAGAGACAAGACGAAGCGCAATACGGAGACCATTGATAGAAATCTCCTGGTTTACAGGACAAGCGATCTACATGTACTACGTGGGCGTTGT
CTGTCCAAGCTCACAACGAGAGGCAAGAGTCTTGGGGCTAGGGTAGGGCATCAGAATGACGATATCTGCGAT