Description :
From Genome Similarity Track
Location :
Scaffold_97:57618- 59105
Sequence
1487 bases(100 bases per row)
ATCAGATCTGGATTTCTGACTTGTCGGAGTAGGGGGGGGGGGGGGGGGGGGGGGGCAAAACAGAGTACCGGTAGTTGTATTATTAAACATGTACGAACAC
CAATAATTTTGGATTGTGTACGAAAATTGGGACCAACTTTAAGGTCTGATAGCGCAATAGTACATGTAACATTGTAAAATAGTTCTGCCAAGTTCTGACT
GCAACAGTGGCCTCGATAATCTATCGAAGGCATATACTGCCACTTCATGGCCGTGATTCAGCGGAAGTCAATGCGCGGAGCCACAGACAGCGAAATCCGA
TGGATTAAAACAGCATGAGTTCACCGCGAGCGCATTCACTGCGGCACATGCGTTAAAGTTTACGAAATTCGTTGCTTGTCCGAGGCGATGACAACGACCG
TGTTGATAACAAAGCACAGATAAAATGTCGTGGCTTTGTGTGAGGAGAATGCACATGTACGTTGGTTGGATGCCACGATTCGTGCGTCGGACGAGATGGA
TCATCCTCCACTGGATGATCCATCGGGACGTCGTAACATGTAAGGACCGTGCAAATGTCGTCTCGACTCGTCAACAGCTACATGTGCACACACGAGCTTC
GAGTCGAAAATTTCGACACGGTGAGACCAGCCCACCACCGACATGGTTTTGTCCAGTCCCGTACGAAAAGGTCCCGGTGGTCCAGTTGTACGTGTGCCGC
CACCGTTAGTCTTGTTGAAGTGAAGGCTCGGCTCAGCTCAATGGCCACAGCACACTAAACCTGGTATATCTTAGTACAATGTCACACTCTACAAATCCAG
AATGGTTGGTTTGCAAACTCCTAGTGAGCAGCAAGGCATATTTTTTTTTCCTGCTTTTACACTCTCTCCACCTGTGGCTTCCTCCTCCAGAATCTCTCTG
CGTGCTATCCTTCGTTTTCCTAATCCTCTGTATGCTAATACTGCACGGTACTTCAACAGGCTGCTGCTTTTTTTGTTCGTCCTCGGGTTGAACTCCTTCA
ATTTGCGACTCTTTTGCATCGCCGTGTCTTGGCTATCCCAAACAATTTGAAAAAAACGTGCACGCCCCACAACGTCCACCAGATCTCGCTTCGTGGAGGT
TTGGTGTGGCTTACCGATCCAGACAAAAAACGAGCTCAGTCAGTGTCTCGCCGAATTTATTGGCAAGAAAGTTCCGGTGCTTGGACTTCAACGACGGTCC
CAAATGGTAGGTCGCACTCACCTTCAGAATGCAAAAGCGCCGATGACTGTGTTGCTGGGTCAAGGATGTAGCCAACTCAACAACTCGGGCTGCCAATTCG
CCCTGACGCGTCATTGACGGGCTGGACGACAACACACGAACAACGCGTTGTTGATATGATCTCAAATGTTACCTTCACACGCGCTTTGAGCGCTGATGGT
AACATTTGAGATCACACGCGCTTTGAGCGCTGATCTCGATTGCCTACTATCTGTTCTACATGTGCAGACTTGGCGTACAGATAAACG