Description :
From Genome Similarity Track
Location :
Scaffold_1:57615- 58627
Transcript NameFunction/comments
Phyag_g13myosin-like protein

Sequence
1012 bases(100 bases per row)
AATCAGAGTATCCTGGTGAGTGGCGAGTCTGGTGCTGGTAAGACGGAAACAACGAAGATCGTGATGAACCACTTAGCCAGCGTGGCTGGTGGCCGCAAGG
ACAAGACCATTGCGAAGGTCATTGACGTGAACCCGCTTCTCGAGTCTTTCGGTAACGCCAAGACGACACGTAATGACAACAGTTCGCGTTTTGGTAAGTT
TACGCAGCTGCAATTCGACGGTCGTGGTAAGCTGATCGGTGCAAAGTGTGAGACCTACTTGCTGGAGAAATCTCGTGTGGTATCAATAGCTGAGGGTGAG
CGCAACTACCACATTTTCTATCAGCTTTTGGCTGGTCTGCCTAGTCGTGAGCGGAAGGAGTTTGGTTTGGACCCTGACTGCAAGTACCAGTACGCCGGCT
CACTTGCGGAGATGCAGATTCCCGGTCTTGACGACAGCAAATGGTTTGCTGGCACGCAAAAGTCGCTGTCCATCATTGGCCTCGATGCCGGTGCACAAAA
GACGCTTTTCAAGATCCTGTCAggtgtgttgctgctgggtgaGGTGATGTTCGACAAGAGTGGTGAGAGCGGATCGCGCATTTCGAGTGGTTCTGCATTG
TCACAAGTCGCCAAGATGTTCGGTCTTCCCACGACGAGAATCGAGGAAGCATTGTGCAACCGCACGGTCATCACGCGCAATGATAGTGTGACGGTGCCGC
TGGCTCCCATCGAAGCGGCGGAGAACCGTGATGCGTTGGCCAAGACCATTTACTCTAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCCATCAG
TACGGATGAAAGCCGCATTAAGGGCCAAATTGGTGTCCTGGATATCTTCGGTTTTGAGGATTTTGTTCACAACGGCTTTGAACAGTTCTGCATCAACTAC
GCGAATGaaaagttgcagcagaagttcACGACGGATGTGTTCAAGACTGTCGAGGACGAGTACATCCGCGAAGGCTTGCAGTGGGATCACATTCAATACC
AGGACAACCAGG