Description :
From Genome Similarity Track
Location :
Scaffold_144:57610- 62322
Transcript NameFunction/comments
Phymu_g5427T-complex protein 1 subunit zeta
Phymu_g5428hypothetical protein PHYSODRAFT_284638
Phymu_g5429T-complex protein 1 subunit zeta
Phymu_g5430FAD synthetase, putative

Sequence
4712 bases(100 bases per row)
ATCACCAAGCAGCTATGAGCTACCGCGGCATGAACCCCAACGCCGAGATCGTGAGCAAGTCTCAGGCGCTTATGGTCAACGTTAGCGCCGCCAAGGGTCT
CCAGGGCGTGCTCAAGTCCAACCTCGGtgcgtctccatccttcTATCCAATTACCAGCTAAGATTTAACCATTTTCTGCCCtaaaacacacacacaggCC
CTCGCGGAACACTCAAGATGCTGGTTGGCGGCGCCGGACAGATTAAACTCACCAAGGACGGtaatgtgctgctgcacgagatgcagatccagcacccGAC
GGCCGCTCTGATCGCACGCGCAGCCACGGCCCAGGACGACGTGACGGGCGATGGCACTACGTCCACTGTGTTGTTTAttggcgagctgctcaagcaggCG
GAGCGCTTTCTGGCTGACGGTCTGCACCCGCGTATCCTGTCGGAGGGCTTCGAGctcgccaaggacgaggctctgcgtgtgctggacgGCATGAAGATCA
CGCCCGAGGACATTCTCAAGGACCGTGAACTGCTGTGCAGTGTTGCGCGTACTTCTCTGCGTACTAAGCTGGACCAGAAGCTGGCAGACCAACTCACGGA
GATTATTACTGATGCTGTGCTGACCATCGCCGTGCCCGACCGTCCTATTGACCTGCACATGATCGAGATCATGCACGTACGTGGACTGGAAAAgcatttt
tattttattaCAAGTGGGGATGCTGACGGGTTTATCGATGGTATGTACAGATGATGcaccagagcagcagcgacactCGTCTAGTGAAGGGACTGGTGCT
GGACCACGGCTCGCGCCACCCGGACATGCCCACGTCGCTGGAAAACTGCTACATCATGACATGCAACGTGTCTCTCGAGTATGAGAAGAGCGAGGTGAAC
TCTGGCTTCTTCTACAACAGCGCTGACCAGCGTgagaagatggtggaggCTGAGCGCAAGTTCACGGACGACAAGGTGCGCCAGAtcatcgagctcaagc
gTGAAGTGTGCACggaagagaacaagaagagcttcgtgaTCATCAACCAGAAGGGCATTGACCCTCTGTCGCTGGACATGCTCGCTAAGGAAGGCATTCT
CGCCCTGCGTCGTGCCAAGCGCCGTAACATGGAGCGGATAACGCTTGCTTGCGGTGGCATGCCAATCAACTCGAcggacgacatggacgagtCCATGCTC
GGATACGCTGGCAAGGTGTACGAGCAGACTCTCGGCGAGGAACGCTACACGTTTGTGGAGGACGTTGCGCATCCCAAGTCGTGCACGATCCTGATTAAGG
GACCGAACGAGCACACGATCGCGCAGATCAAGGACGCCATCCGCGATGGTGTTCGTGCTGTCAACAACGCCGTCGAGGACAAGGGTGTTGTtcctggcgc
tgctgccttcGAGTTGACCGCCAACGAGGCTCTCAACAAGTTCAAGGGAACGGTAAAGGGCCGTGCCAAGCTCGGCGTGCAGGCCTTCGCGGATGCTCTT
TTGGTGATCCCTAAGGTGCTGGCGGAGAACTCCGGTCTGGACGTACAGGACACTCTGATTGCCGTGCAGGAAGAGCACCAGAACTCTGGTATGCCCGTGG
GTATCGACCTCTTCTCTGGCGAGCCTATGCTACCGGAGCAGGAGGGCATCTGGGACAACTACCGGGTGAAGCGTCAGTTCATCCACCTCGCCACGACGTT
GGCTTCGCAGTTGCTACTCGTTGACGAGGTTATGCGTGCTGGCAAGCAGATGGGTGGCGGCGGCATGGCTGAGCAGTAAGTAGGTCGGCGGATGCGTAAG
TAGTTTATTTCCCCCACTAGCCCATCTACTCACCTCTCAAAAGAGTCATAATAAACCGAGAAACTCACATCACCGCTCAGTTTTACTAAAAAGCCAAGTT
GCTGTATTTCCTGGACACTTCAACGGATAAACAATAGATAGAACACCAGGACGTCGGTGATTGACAGTGCCGCGATGACCATGTACAGGCAGATTTTCTT
CCGGTACGACCGGTCGGCAAtgatctgcagcaggtggcgcACTTGGCCCGTCATGCTCGACGTCTCCGTCACCATACCCTTCATGTCGTGCAGCTGCGAA
CGCTGTAGCTCCAgatccaccagcacgttcttggcCACCTCCTCCGACTCGGCCACAGTGCGTCGCGTGCGCTCAATATTGTCCGATGTGCGCATCAGCG
ACCGCACACTCTGTCAAAGTCATTAACATATAAACATTAGTCACAAAcaaaaaataataataaatATATCTGCAGCCCATTGACGCACGGGATCTCCAGC
GAAGAAGGTGCTGTAGTTGTTGAGGCTGGAAGGATCCGGCCCTCCGCCTGTGACGCTGCCACTGTTGCCGTCGGCGAAGATGCCACCTCCGCTACTGGtc
gtgccgttgctgccggtCATGGCGACTCGAGGCCCAAGCAAGGCGGTCCGTTCCCTGGCGttggagctcgtggttgcTAAGATTTTTTAGAACGGAAATA
TTGCGGAAGAGAGACCGATAGAAGATACCGCAGCTGGTGGCACAAAACGACCACCGAATGTACATTTATAATTGAATGTTTTCGCACACAATCTGCAGTT
TTTTTTAGCTCCTCGTGGAAGAAATGAGCTTCGGGAAGACCAACTACCGCGTGGGCGGCACACGCGGAGGCGCCGACCGTACGTCGCTGCTGAGAAGTGT
ATTGGTTTAACAATTGTGTTTACTAACTGTGTATAATTTCCCGTCGTTTGTATCGCCAGAATTCAAGTGGGAGGACGTGAAGAATGACAAGTATCGAGAG
AACTACCTGGGCCACTCAGTCCAGGCGCCTGTGGGTCGCTGGCAGAAGGGAAAGGACCTGACGTGGTATGCCAAAGCCAACAAGTCCGAGAGggctgaag
ctctgcagGCAGAACTGGCACTGGCCAGGCAGCGCGACGAAGACCTCATGAACGATGCTCTGTACGCTGGAATGGATTATTTATTAGACAAGGTGGACAG
AATCTTACCGTGCTATGTTGTACGCTGCAGAGGTATTGCGCCTAAGAAACGCCTCGAACCTACTGGCGGTTTGAGTGCgtcggagatgaaggagctgctg
aagcgtgGGGAGGCCGAGCGTGATGGTTTAGATGTGGAACGTGTGGAAGGCCTCggtgctgcaccagtggACGCTGCAGGCTTTGAAACCGGACCGAAAC
GTACACTTGCGGAGAGGTACAAAGACCAACTTGGCAAGGCAGATACAACGTATGCGTTGCCTGGTACGATCAATGGGCAGATAACAGAGAGAGAGGCAAA
AGCGGCTCGGAAGGAGGCGCGCAAGGCGGATAAGGCAGCGaaaaagctgaagaagaaagaaaagaaggagcgcaagaaagaAAAGAAGGCCAAACGCCAT
CGTGACTTTGACTCAGATGAAGAGGTTGAGGAAAAGGTGCAACGTCATCACCCCCGCAAGGATGAAACGGATTCATCTACTCGCGATGTTGCTCGACGAT
CACGTTCTGCTACCCGACAGCACGGAAGCGGACGAGCGTGTTCTCGTTCGCGCTCGCCAGCTGATCGTCGTAGAATTGAGAGCTCGCCCAGACGCCGTGA
GAATCCTCGCAGTCGCTCCCGGTCACCTGGGAGCCTTTCAAGCCGATACCGTCACCATCGTCACcgatcgtcgtcactgtcacCGGCTCCTAGAAGACGT
TCGCGCTCTCGTTCTCGGTCGCGTCGTCATTATTAATCATGAACTTGTGTTGATCAAAGAGCACTTGAGGCGGATTTGTGCACAAAGTTCCTTTCTGATT
CTATTTGCTTGGATTATTCGTAACGAAGGGTAGACTTGCTACCAGTTCGCTGCCCGTTATTTCACTCGGCTCTTAGTCAGATTTTGATGTCGTGTGTGCC
TTCTTCTGTCGCCCACAGCGCTCCGAGCTGCCATCCTTAAGCTCGTAGGCAGGAAGATAGTATCCTTCCTTGCCATCCTCACCCTTCCGCCATAGTTCCG
GGTTCTGTACAGTATCGAAGATGTTTCCTAGCGATGTGTATCCATGGTCGTAAAGCGAGCAATACTCCAACTGACAGTCGCGCAGGAAACTCCACACATC
CGCATACGTCCACTGCAAGATCGGATTCACGCGCAGGAATGGTGGCCATCCAGGACTACTCGGTGAGAAGTGCTCCATGTCTTCAGTGTATGGGTCACCA
CCACGTACACCCATGTAGATGCCCTTGATCTTGAGTTTCTCCAAAATGTCCTTCACCCCCTCCACAAACGAGCACTTGTACACATGGCAGCTGAGCGAGT
ACTTCTTGGTACAGTCCTCCGTGAACTCGCGCACCTCTGGGAACTGATCGTACGAGTCGAAATACATGACAGGCACGCGTTGCAATTGCTCCTTGacacg
cgcttccagctcgtcttcctgcAGCAAGTCAGCCGAGACAAAACTGTTCCGCGGCGATGTAACAGTTGTCTTGAGGCCGTCACCAGCGCTCTCCTGTGCT
TTCGAGTGCGCTATCTGCACCTCCTCCAACACACGCTTGGCTACCACAATGCGGATCAGGTGAAGCACCACCGTTGAGTCTTTCCCCCCGttaaagctga
agcagacgccCTCCAGACCGAAAATGTCGATGGCGCTGCGCATCACGTCCAGAGCCTTTTGCAATCGCTTCTGCATCGCTGGATCAGCGCCAGCAaagaa
gagatcgaagcG