Description :
From Genome Similarity Track
Location :
Scaffold_215:5761- 6772
Transcript NameFunction/comments
Hyaar_Emoy2812694Eukaryotic/viral aspartic protease

Sequence
1011 bases(100 bases per row)
GCCATAAGGCACGAAGCTCACTTCTGCAGACGTCGATGCAAGTTCTGCGAACAGGTGCATGAGATTGGCCGGTGTGAGTTGTTTGCGCGACTTGAAAAAC
TCACCAACTTTGTCAAAACTACGGTGAACAAGTCATTAGTTCCTAAAGTCCTCCACGACATATACTCGTCAGGCCTTTTAAACTAGCAGGCTCGCCGACT
TTGGGTCGAGTAACAACGGGCTGCCACAGTCAGTTGAACCAGCAGTGAAAGCGAACTACGTGTTTGCCTTCGTTGAGGATACGAAACAACCCGACGAGTG
GTAGGATCAAGAAAAGGAGATGAAGCAGAGCGAGTGGGACAATGGTAACAACAGAACGATCGCACGGATGGACGCGAATATACGACCGGGATCAACGATG
CGGACGGCGAGACAGGTACGATTCCTACAAGGCGAAAGACTTGGATTGTGGTCGTCGAGGAAGTTCGATCGCCGAGTTCGGATGCGGGCGTTGGGCATGG
GCCCTGTCAATGACGAACGGACTAAAGTTTTGCTGGATACTGGAGCTAAGATTTCAGCAATTACCGAAGCGCTCGCTAGAAGACTGCGACTGCAACGACA
AGCAAATTGATGTTCAATTTATTGGGAAGTCGAAGGTATTCACCACGTCACGAGCAACAGTCAAAATTAATTTAGAATGGGAAGTCGTCTACGAGTTTGA
AGTAAGGATTATGCCACACCATGCGGGGGTGGACCTGATACTCGGAACAGACTTCATGATACCGGCCGGGATCCGGCTAGATCTGTTCAACGCGACGGCG
AAGTTACCAGATGAAATTGCGATTCCGCTGCTCAGGTCGGTACGAGAAGTCGACGAGTCCACGCACGGGGACGAAGTCATTGGAGGACCAACTGAATCGA
TAGACATTGAGAGCCTCCTGTTTGAGGAGTTCCAACTCCAAAGTAAACAGCCTGAAGCGTCGATCCACGAGCTTTTGATTCGCCGACTACCAGCGTTGGT
ACCGACGATAG