Description :
From Genome Similarity Track
Location :
Scaffold_8:57608- 58662
Sequence
1054 bases(100 bases per row)
AGAGCGGACTACAAGTTCTTTGTGAAAGGTCACACGAAGAACGCTTGTGACTGTGGATTCGGCCACATTCGCAAGCACGTTTCTCGCCAGGATTGCTGGA
CAACGGATCATATTATCTCCGCTGTGAACAATTCTGCCACCTCCAACACTACCGTTCACATCTCGCGAGGCAATGTATTTTTTAAGAGCTTTAAACCAGT
AGTGACCGAGCTCTACAAGAACCTAACAAGCGTGCAGCAGTACCAGGTGTTATCTATGGTTAAAGATCAGCCTGGAGTTGTTTTGTGCCGCAAAGGACCC
GGCAACGAAGCAACTAGACAGGATCTGCGGCGAAGCGTTGATGGAGTTGCCACCGAAGACATCAAAGTAGATCGCAGGTTCACTCACTTTCTGGAAGACC
TGAGCCCTCCTCCTCTCAACAGCGAAAACCAATGCTAGATCTGCACAACAAAATCAACCCGTATGTGCCGGAAGAGTTCCAAGATGTCCTATCTATGCAA
AGCCAAGGGAGCTGCAACAGCAAGACGCTAAAGCAGCCAAACAAGCTCGTTGAGAACACCGAGCTTCAATGGCTGCAGCAGCGAAGGCAAACCAGGACCG
GACGTTCAGGATGAGAGTCGTCCTACTCCCAAGATGGTTCGTAAATGAAGCAGATCTATTCTGCAACAGACACATTTTGTTTAGTCAAAATGATACCTGT
CTCCAAAATAATACAAAATGATACTTATGGTACCATATCACTAATGTGAAACTGTGGATAAAATTAAAGTTTTGCACATGTTCCAGTAACAATTGGAATA
AACGGACAACACCATTGGCTCCGCGCGACAAGTTTACGTCAGAATGTCAAATAAAAAATTCCTTTTTCAATTTTGGAAACGAGATTTTTTTTCTAGCGGC
TCATAACTCAGTGAGATCTCGGTCCTAGAAGCTAACCAAGTGCTCAAAAGATAGAGGAGACGCCCCTCTTTCCCGTGGTGTGCTTAAATCGCGATTCGTA
CTTAGTTTCATTAGTATTATTTTGTTTTGCGTGGTCTCATTTGAAGTATCACGA