Description :
From Genome Similarity Track
Location :
Scaffold_1424:5760- 6835
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1424-snap-gene-0.3Calcineurin-like phosphoesterase

Sequence
1075 bases(100 bases per row)
ATGAAACCCGCGTTGATCACCGCCACGTCCGCATGGAGCTCTTCGCGCAGCGCGTCTGCGATCAAGTTGCCGAGATTCGTCTCCTGGGTCCTGCAGGACG
CCCGCGAGCCGTCCAGCATCGTGCGCGAGACCGCGAGCACGTCTAGCTTGCCCTGCGCCTTGAGCTCTCTATAGACTCTGTCCGAGTACTCCGTGATGAG
CGCTCGACACGCTGGATCCGGTTCAAAGCCGCGATTACAAAGCATTTGCCACTGGAACTCGACGCTCACCGTCGCGCTCTTGTCGTAGGTCTCCTCGGTC
TTTGCGATCAATAGTTCCACGATGCCGAGCCAGAGTGCATCCTGGCCCGACTTGTGGATCATCGTCTCGCCCTTGAACAGCGTCATGATCTCGTGGTCGT
GGCCCCCTAGGATCAAGTTGATGCCCGGCACTTGTCTCGCGAGCGCTTTGTCCTCCGCGACTTTGAAGTGCGTGAGCGCGACGATCGCGTCGGCGCCCAG
GGTTTGCAGCTGCGCCACACAGCGCTTCGCGTGCAGCACTGGGTCTTCAAAGACCACCTGCTCGCCTGCGAACGGGTCTTCACCCGTGACCGTCGTGGAC
ACCCCAAAGAGCCCGAGTTTCAAGCCGTTTGCTAGTGGGAGGACTTGATAGTCCACGAGTCCTGGGAAGAGCTCGCCATCTCCACCATTGGAGCATCGCT
GCCGGATATTCGAGCCAAAGCTCGTGAAGTTTGCCTTTGTGAGCAGTCGTGAGAGCAGTGGCGCACCGAAGTCGAACTCGTGGTTGCCCAGCACGACGAA
CTCGATCTCAAGAGCGTTCAGCACGTTAATCATGAGCGCTCTGCACAATACAAGAAGAGCAACAGCAATACGCTTAGTTCAGCTTAGCAAGACCAGGTCA
TTACCAATGTACGATGCTGTGCTTTGTAGCGCACGCATGCACCCTTTATCTTCGCGGTCGAGCTCGGAGCGCCAAAGGAAGTCACCGTTGAGCGTCACGA
CCACGTGCGCGTCGCTTGGGATCCGTGCTTTAGCCGCTCGCAGCAACGTCGCGAACTCCGCCACACCTGTACGCC