Description :
From Genome Similarity Track
Location :
Scaffold_785:576- 5492
Transcript NameFunction/comments
Phyta_totarag10709hypothetical protein

Sequence
4916 bases(100 bases per row)
AACCGAAACCGCTCATGGTGAACGTCCAGGTCTTCGAAGGGACGTACGGCGAAAATCTCCTATTATGGACCCGCGAGGTCGGAATGGCTATGAATTCAAC
CATGCTCCGAACTGATCAGCAGCGCGATAAGCTGGCAATATCTAAGCTCGGTGGAAGAGCCCGATAAGGGGACTCACATGCGAGGTGACTGTTGATACCA
CTTACCCAATCTGGGAAGGTCTGAAGCGTCAGCTGGCGAGAATGTTCTCTCAGCCTAATCCCGCATACCGCGTGCGCTATCGTTTCTTGGCTTGCCGTCA
AGGCAAAAAGGAGTTGGTGGACTATGTCCAAGTGCTACGCACGCTCATTGCTGGTATGTTTGCCGACCCCCTGTCTGAGGTAGTCACCGTGACAGTGTTT
ATGGAAGGTCTCCGGACCGGGTTGATCGAGCGAAAGTATTTCGAGTTCACCCATCTTCGTTTGATGAGGCCGTCGCGGTGGCATTGAATGCTGagcacaa
cttcaagtcgGCCCGACTTAGTTGGAGGGCATCGCACCCAACCCCCTCGGGTGGTCCGTACCCCATGAACCCTAGCTACActgaagacgaggaagctgAG
CTTCtagctgctgagcagcgtAAGAACACCCGGGCGATGATTTACCTGTGGCAGTACTCGACCTTACGCATGGGATACCCCCTGCGCAAACAGCGCCAGG
CTCAGCAGAGCCTTAGCTCCGCTCCCAAACAGGCCTCTGGTTCGTCGCAGGGAAACGGCGAGTCCCAGTAGGCGTGGGGCGGCCTACTGGGAACGAATCG
AGTTCTGTTGCACTTCGAGGATGTATAGGTCGACAGGACTCCGCTCCTGAAGAGTTCCGAACTCTCTAACACGGACCGTGTATGCCAACCAGGCTTGCTG
GCCGTCCAGGCGACCGTGAAAGTCTTTGAGAAGCCGCGGGCAGCTTTTATTGACTCCAAGGCGTCGGGCAGTTACGCTCGACGCTCTACGATAAAGGGAA
AACAACTGTATGTTGGAGCGCTGGCAGCGCACAGAAGTGACAGCGTCACCGTTCGCCTGGCGACTGCGACTAGTGTCACGGTGCCCAAGGTCGCGGTGGA
CCTGGGCGTGAAGTTCCTGGACTTTGACAGTATGGAGCTCTGCCTGGTCCTAGACCTGGATTCGAGGTACGACCTTATCCTTGGCATGGCATGGATCGAC
TGGAGGTCGAAAATATTAGGTGCTGCGCACGTCTCTGGTGGGGCCTTGGCGAGTCATGACCCACCTCTGCTAGGAAACAGAAGCGCTATTGGCGCGAACA
CTTGGTCGAGTCGgccatggtgctggacattGGTGTGTCCGAGTTGATGGACAACGCTGAGGTCGGGGATGTATAGCCCGAGCACGGCTTGACGTGCTGA
CGTCGAGAGACCTGAGCACGCCTCGATGGACCGATGTGGAGCGGTACGTAATTCGCTGAGTGGTGGTCGATTGGTCGACACATCGCTGCGTGCAAACGAG
AGCACGGTCGGCTGCGAGTTGATGTATCAAGGGCTTTGCCCGGAGAATGCGCGTGGAGCGACACGTATTCCGCTGAGTGGGGCTGTCGGTATGGCGCACC
ACTGAGTGCTCACGCGAGCGCTGTCGGCAGTGTGTCGAGGCAGCAAGGGCCTGGTCCTGGAGGTGCACGTGAGGTGGTTATAATTCCACCGTATCATGGA
CATTTATCGCCGAGCGTCCTTGAGGACACGGGTTCCACCGGGAACGGTAGTGCTTTCACACCGGTACGGGATGTCAGTGATGCTGCTCCGTCGCCCTCTT
CCACCTAGTCTCGGGCACGGATGAGGGTGATACGCAGAGCGTCGGTGACGTCGTCGGTGTCGGACGAGATGTCCAGCGTGTCAAGCAGCAATGATCAATG
CAACTGCAGCGAGCTGTTGTACACACTCGTGAATGCAGTGACGGGGGAAGGTGATGGCGACATCGGCCTTGAGTCTCTCCCCACTGTTGAAGCTCTTCta
gagctggacgagatgtcTGTCGCCAAGTTCGGTGAGGCCTTGAAGGTGGGCGATTTTGCCGAAGTGGTCATGATACGACCTAAAGAGGAATTAAACTCCT
CATCCCTTGTGAATTAGGCTGTCCTTGAGACCACCTAGAAGGCGCTCAATGCGACAAGCGGATTCAAGATCCTTAAAGATCCCTCAGATCCGTTCTATCT
GTTGCTGGTAGAGTATTGAGACGTCGTCTCGAAGTACCCACCTATGGGTCTGCCTCCGGATGGAGGACTTCGTCACAAGATTGACTTGGTTCCGGGAACC
AAATACTGCGTGACGAGGCAGTGGCCTCTGCCAAGAGAACAGTGCGGCATCACTGACGCGTTCCTCCCTGCAAGGCATGAGGCTAGTCTGGTGGGTGAGA
GTAAGTATCTACACTCTACACCGACATTCTGTGTCAGAAAGCCAAACGCCAAGTGGCGCATGGTTCATGccttcaacaagctgaatGCAACCACCATTCC
GGCGCAGACTCCAAATCCTCGGAAGGACGTTTTCCAGAACAATATGGCCGGCTGTACGCTGTACAGTGTCTCGACTTGGTTAATGGTTACTACCTGTTGC
TCATGAGAGCGACTTATATCCCGCTAACAGCCGTCAGTACTCCGAGCGGCATGCTCTGGGAGTGGCTGGTGATCCCCAAGGGCTGTTGAACGCTCCGGAG
ACGTTCAATCGTCTGGTGACGCAGTTGTTCCGGCCCCATCGGGCGAACGCACAAACGTACTTTAATGACTTATTTGTCCACAGTCGTGCAGACCACGGGA
AGTCAAATGTGGAGAACCACATAGACCATCTGcgagcagtgctcgagtacatgtGCACCAGCGACTTATACGCCAACTTGGACAAATGCGTCTTCGGCGC
GGAAGATATCCCGTTCCTCAGGTACTTCATTGCGAAGCGAGGCCTCGAGCGGATCCTGCCAAGGTTAAAACCATCGTAGTGGGCCAGTTCCAAAGAACGA
AGAGGACTCACGCAAGTGGTTGGGCCTCGTCAATTACTTGCACAAGTTCAGCGAGGATTACGCCGAAATGACAAGGCCATTGATGAATCTCCTTAAGAAA
GATGCTGAGTGGTGTTGGGACACCAAGCAAGGAGCCTTTGAGGTGATTAAGGAGAACCTCCTCCAGGCGCCGATCCTGGCGCTCCCGGACCCGGACTGTT
CGTTCAGTGTCGTGTGTGACGCATCCGACTTCGCTATCGGATGCGCTTTGCTTCAAGCGGACGCCAAATGGCGCGAACGCGTAATCGCGTTGAGTCTCGG
CAGAtcaaggctgctgagaagaACTGCCCAGTTTATGATAAAGAGCTACTCGCAATGAAGTACGCGCTCGTCAAGTTTCGGATCCACCTGCTCGGCTCCA
AGCCTTCGTGGGTTACACGGACCATGCGTCATTACGCACTGCGACTCAGTCGCCTCACCTCTCTCAGAGAATAGCCCGATGGCTCTCCTGCTTTGCGGAT
AATAACTTCGAGGAAAAGTTCAAGTCGGGCAAACATAATGTTTTGGCTGATGCGTTATCACGCAGACGGGATTATAAGCTTGCTCATGTCACGACCGTGA
CGTTGTCCATGACGGAGCTGATTCGGGCGGCTTACGCAAGCGACGACACTTGTGTAGCTCCGCTACTTGCTCTAGGGAGtgaggagttgctggaatCGTA
CATGAAAATGTCGGTGCGCTCTCGCGCGAGGCTACATCGATATACGCTCGATAATGGCATGCTGTATTACAGCACAGGTACGGACGACACGCCTCCCGTG
GCGGTCCCTCAGGAGGAGGACTTGAAGTATCCCATCCTCTATGAGGCCCATGACACACCACTTGGTGGACACCTTGGTCGTGAGAAGATCTATTGCGCCG
TCAGCGCAATGTACTGGTGGCCGAAGTTGTTCAAATGGCCCAGCACATGATGCGCACGTATGAGTCGTGTCAACGGGTGAAACCCTAGCCGCATTCGGGC
GCGCCATTGGTGAGTTTGCCTGTCCCCACGGGGTGTTTGCAGTCCATGAGTATGGACTTTGTGTTTGACCTGCCGAAGGACTCGGCGGGCAACAGTCTTT
GTGGACCGACTGAGCAAAAGGGCTCACTTGGCGGCTGTGCAGGACTCCGTGGACGGAACGGGTACAGCTACGCTGTTTATTGACCTTGTCTTTCGACAAC
ATGGCCCCCCAGAGACGATTTGCTCGGATCAAGACCTCCGCTTCGCGGGGAAGTCCGTCTTCGATATGCTGGGCACTCGCTTGGACTTGTCCACGGCGGG
TCATCCGTAGACCGACGGCCAGACCAAGCGCGTTAATCACGTAGTGAAATACGTCATCCACAGCGTGTGCGCTCACACGCAGATGCGTTGGAACGTCATG
ACCCCTCTCGTCGAGTTCGCATTGAACAATACGGTGCACGCCTAGACAAGCTTCACCCCGTTCTACTTCAACGGCTTGGCACACCCTCGTGTTCCGCTAA
CACCGCCACGCACAGGCCTTGGGCTTGGTGGGGAGAAGTCGCCGACTGGATAGCAGATATCAGCCCTTCTCCTGTGCGTAAGCATGTTGATGACTTCTTG
TCAACGCGTCTCAATGTCTTGCGACATGTGCTTGACACAATGGCTGAAAGTCAAGATGTTGAGAAAGAACAGGCTGATACAAGAGATCGAGGCAATGTTG
AGAACTTTGAGGTCGGGGACCTGGTTTTATTAAATGCCAAGAACCTTTCTATGAATGCAGTTTCGGTGGtcttcaagacgaagctgcgccCCCGCTTCGC
CGGACCGTTCAAGGTCGAGGCCAAGATGGGCCTAGAGTATATGCTCAACCttccgaagaagatgcgtACACACACCCAGTATTTTACATGGACTTGCTCA
AGCCGTATCCGGACCC