Description :
From Genome Similarity Track
Location :
Scaffold_1935:576- 3469
Sequence
2893 bases(100 bases per row)
ACCAGATGCCTTGACGGGTAAACCCGTCTCGCTATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCG
CTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGATCTTTGCTGCCCACGT
CTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAA
GGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTG
TTACTCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAG
TGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATCAA
AACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGTGCCCCGGGTCCTGACAGAG
GTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCC
AGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAGCTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGAC
GTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGA
GCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATCCTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGCA
ACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGAACTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTC
TTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTACCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGG
ACCGTCTGCGGAGTCTTTCCGCGGAACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTC
CATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCT
TCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGTTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAG
TCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACA
CGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGCTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGG
GATGTCGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGAACAGAGCCGCGT
CCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATATGGCTTAACCTTCAGCCGTATTGGCTGCGGGTGAGGCCG
ATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCTCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCC
GGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGTGAGTCGTTCATATGGGAGAAGTCGT
TCCTATCCATGACAACGAACTTGGAGAGGTCCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCAC
CTTGCGCTAGAGGAAGTTATCTAACGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAAAAGAGCGAAGTGACCTAAA
TAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGAGGTTAATACAAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAAT
GGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGT
ACACTTAGTGCTACGTACCCCGTTACAGCAGGGCCTCCATCCCGAAGATGCCTGTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGG
GGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGC
AGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCAGGATCCACCCTTACCTG