Description :
From Genome Similarity Track
Location :
Scaffold_201:576- 2323
Transcript NameFunction/comments
Phypl_g5175HECT E3 ubiquitin ligase, putative

Sequence
1747 bases(100 bases per row)
CCGTGGTGAACCCATACAGCTCAgtgtccagcacggcgtaGAGCATGCGCCTGAGCtccgagcgcgagatgccCAGCGGCAGGTCCAGCCGATTGAAGCA
CGCGTAGCtgcgcacgaactcgtcgggCGCGCCCACGATGCCGCGGATCGTGAAAAGGCACACCTTGCCGTCGTAGCTGGTGAGCCCCTTGAAGCCCACG
AGCGGCACACGCGAGCAGCCCGTGGtgaactgcagcaggcgccgccgGTACTCGTTGGGCATCTCACGCACGATTTCCCAGAACCACCCGAGCGTCGGCG
ACCGCGCCACGCTCTCGGCCACCGACGTGTTCTTCTCCcagtcgtccacgtcgatcGCCGGGGACCCACACATGAGGTAGTCCAGCTCTTCGTAGTCGAA
CAGCATCAATAACTGCTGCGGGATGACCTCGTAGATGCCCTTGAGGAACACGTACAGCTGGTCGGCAACACTGCGCAGTAGTAGGTGCTCGAACTTGCGC
TCGAGGTACTCGTGCTTATTGGCGTCCGTCACTTCGATGTTGCGTCCGTTGGGAATGAGATCGACCGTCATGGTGCGGTCGACCATGCGCTCCATCACGC
TGAAGTCaaggtccagcgcctccacgccgtcgttctccagcatccacgtcATGCTCTTGTAGACCTCCGGGTCAAAGTACTTTACGTCGTCCATACACAG
TGGCGTGCCCAAGatgagcttgagcagcgggaCGCACAGGTGGAAGTTGAGCACCGTGCCCTCCAGCAGTGCCCGCCCCAGCAAGCGCCCCGCTCCATAC
AAGTAAATAAGATGCTCCTCGCCATTGTCGTAGCGGGAGTTTGAGTTCAGGAAGAACCCGCGGTCCTCTCCGTTGATAGCCTTGAACAGCCCCGCCTTCG
GgtccgtcagcagctccgttAGCATCATGAACCACTCGCGATGCAGTCCgccggcgtccacgccgctTTCCTCGAGGAAGTTGATGCGCATCGCCGAGCG
AATGTACTTCTCCTCAATGCACCCCAGGTGCTCCATCGACTCTTCAAACATGTAGTCTCTGTGAATCGACAGCTTGAGGAACTCGACCTCGGGCGGGACT
AGCAGCGATGCTGTGCTCTTCACAAAGTACGCGTACTTCGACGGGAAGTCCttcgccgccagctccagcgtctcgcgACGGCGGTCGACACCTGTTTGCG
TGTCGTCCTCGAGGACTTCCCCTGTAGAACGCGCCGCTGCGTCCCATTTCGTGGCCGGGATGATATCCATGTCGGTCACCTCATTAAAcaccttcgcctt
cgccggctccacgacggccacctCGCTGTGCATCGCTGCTGGGCCGTTCACCTGTCCGGGCATCTTCGCGTTCTCGTTGGGCTTCACGAACCGAATGACC
TTCCCCACGCGCGCGGGCGCCATAGGCCCGCTTCCTTCCTTCACGCGGAACCAGAACATGTTGCCCTCCACATCCAGCTTGCGCGTCCATTCTTTGCGTT
TCCTggcgcggagctggcgctgggtcAAGTGGtgcggcagcgcgctcgccctagccttgcgctccttcttctccttccgccggcgcttcctcctgcttgt
gctgcttccGTCGGGCGCCTCGCGCGTGTCCATGCGCTCCCCGCAGAGCGAGCAGAAGAGCACGTCCTTGAAGTTCTCGAACTCGCACACGGCGCACACC
TCGAAACCCTTGTCGGCCTCGCGGGTGGCTGTGTCCAGGCGGTGGTC