Description :
From Genome Similarity Track
Location :
Scaffold_32:57586- 58769
Transcript NameFunction/comments
Phyta_totarag1641hypothetical protein
Phyta_totarag1642conserved hypothetical protein

Sequence
1183 bases(100 bases per row)
TATGCAGATGACGTGGAcccactgctgcagtcgctctTGTACAGCGACATGGACTACGCTGCGATCTAAGCGGCAATAAGACCCGTTGGCTGTATGTAAA
CCACGGTTCAAGCATGTTTTGTGGTTACTAACCAGCACAATCCAGTTTCGTATTTCAGTTTTGTTTCAGGTCGTCAAGACCGAAGGCATCTTTACAGTTT
TGGTACACTGCGGCTGCAAGTTCATCAATCGCTACACCTCGGATCTCTGCCGCACTCTGCAGCGTGAGTTTCACAATAGCAGGTTCATTTACACGAGCCG
AACCCTCGCTTAGCATTAGCGGTGTTTCATCACCCTGCACCATAGCGCTGTTAAACACTTGCTCTACAAACTCAACGGGAGGTGCTTGGTCAGGCGAATC
TGTTTCAAGTAACAGAACTTCCAGCGGTATTTCCTCACAACATGCCGCTGCTTTCTTCATTCGCGGATCCGTcagctgcttggcgttcagtgagaagaag
acgctggtgccTCGTAGCGCCAGAAACGACCGCACCATGTCTGGCGGTCCGCTATACGAGTGCAGTACAAGAACTGGAGGCAACCGTCCGCCAGCACGGC
CGACATCTAGCAGAATCTCCAATAGTTTGCCATAGTAACCCACGCAGTGCAGCACACAGGGTCTCTCTAGctccgccgccagctccagctgcgctcGGAA
CGCCTTCACCTGAACATCCACCGGCACCTGTTGGCCCCGAACGCTCTTGCACAGCCCAATCTCCCCCACCTACAGGACAACGAATTAGTCAGTCAGATTC
AGATTTTGACACCATGGTCAAGGtaacttcaagttgaagatgtcAGAATCAGATTTTTGCTAGTCGTACACTTGCTCTCGGGTGGCGTGTCAATGTGTCC
CGCAGCGGCTTTAGACCGTCTGGAATCATCGGGGCCAGCTCCTGCGCCCACCACGGATGTACTCCAAACGCTGGGACGATCTTAAGTGACCTGTcgtgct
tttgctgctccatgagctgctccaggacGCGCCAATCCTGCTCGTGTGTGGCGCAGGACACGACGTGACTCAGATGGGCACTGCGGGCCCTAGAAAGCAC
GCCTTCGAGCCGTTGACAGTTTGGTGGAGAGCTAGAAGACAACAGGCGCTCATCGTGCAGGTGGCAATGCGCGTCGATGAGTG