Description :
From Genome Similarity Track
Location :
Scaffold_134:57579- 58690
Transcript NameFunction/comments
Albla_Nc140794803hydroxyisobutyrate dehydrogenase putative

Sequence
1111 bases(100 bases per row)
ATACCATTTAGTTGTTCCAATGCAATCATTAGCGCCTGGATACCTGAGCGGCCGTGCCCGTGGGCCTAAAGTAACAACACGTTTTTTTCAGACATTTTGA
ACGTGACGCCAATGAAAACAGGGTTCACGAACCTTCGCAGCGATGTAGAACTGATGAGCCAATGCAAGTCCTGGGAGTGACAAGCGCATTCTAAATAGAG
AAAATAGTATGAGAGTAGTCAAGGCAATTTTGAGCGTGCTTGGGTACTTTTGAGCTTCTTGAAGAGCAATTGCCATGTCTTTGATAAAGTGATCGATAAA
GAATCCAGGCTCAAAGTCCCGCTCGGCGATTCGCGGACCTAAATGACTGATCGACCAAGATCTAGCAGCTCCCATGCTCACGACATTGATGATTTCGTTT
AATTCAAGACCGCACCGATGTGCATATAAAAGTCCTTCTACAACACCAACCATGGTCGAAGCTATCAGAATTTGATTCACCATTTTAGTATGCTGCCCAG
CTCCAGGACCACCCATGTGGCGAATGTTTTTTCCCATTAGATTGAAGTAAGGCATCGCTGCATACACTGCATCAACGTCACCACCGACCATTATAGATAA
TGCCCCATCACGAGCCCCAATGTCTCCACCAGAGACTGGAGCATCTAAAGCAGAAACACCTTTTACTTTCGCCATTTCATATAATTCTTTCGCGAATGTG
GGTTCATTTGTGGTCATGTCAACTATGATTCCACCAACTCGCATTCGACTCAAGATTCCAGTATGAGGATCAAGTATGACTGAATGCACCTCGGATGGAT
ATCCAACCATAATGAAAATGATATCTACCGATGAAGTGCCGGATTATTACCCCGATTGTATAATGCAATCAAATAACTGACCTGCATAATTGGCCACCTC
TGCTGCATTTGAAACAACACGTGCGCCCTTTTCTTGCAGAGCATTACATTTGCTGGGTGTGCGATTGCATACTGTCACATCATATCCATGGTGCTGAGCA
GGACCAAAGTTGCGTTAGGATTTGAGGGAAGCTGGTAATAATGATGAGTGCGTACGAGTAGATGGCGGCACATGCTTTGACCCATTATGCCTGTGCCGAT
CCATCCCGCCC